\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015985372:

Variant ID: vg1015985372 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15985372
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGCCTCAATCACGTCACGCCGCTCGTTGCTCCTGCGCTCTTGGTGACTTCTCGGCATCTCGCAAACGAAAACAGCAAGTTGGCAAATCGCGACTCGC[C/T]
AGTAACCACGCTCGTGTCAATCGTCCGCCGGTCGACTTCTCTGCTCGCTACTGCTATTTATTTTTCATTGGAGTTTTAAAATGTTATATATAGATAATTT

Reverse complement sequence

AAATTATCTATATATAACATTTTAAAACTCCAATGAAAAATAAATAGCAGTAGCGAGCAGAGAAGTCGACCGGCGGACGATTGACACGAGCGTGGTTACT[G/A]
GCGAGTCGCGATTTGCCAACTTGCTGTTTTCGTTTGCGAGATGCCGAGAAGTCACCAAGAGCGCAGGAGCAACGAGCGGCGTGACGTGATTGAGGCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 0.10% 13.56% 14.58% NA
All Indica  2759 64.50% 0.00% 18.12% 17.40% NA
All Japonica  1512 91.00% 0.00% 0.53% 8.47% NA
Aus  269 34.60% 2.20% 40.52% 22.68% NA
Indica I  595 52.90% 0.00% 21.01% 26.05% NA
Indica II  465 55.30% 0.00% 22.80% 21.94% NA
Indica III  913 74.70% 0.00% 14.46% 10.84% NA
Indica Intermediate  786 66.80% 0.00% 17.43% 15.78% NA
Temperate Japonica  767 96.50% 0.00% 0.26% 3.26% NA
Tropical Japonica  504 90.70% 0.00% 0.40% 8.93% NA
Japonica Intermediate  241 74.30% 0.00% 1.66% 24.07% NA
VI/Aromatic  96 72.90% 0.00% 16.67% 10.42% NA
Intermediate  90 80.00% 0.00% 8.89% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015985372 C -> T LOC_Os10g30680.1 upstream_gene_variant ; 4847.0bp to feature; MODIFIER silent_mutation Average:61.698; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg1015985372 C -> T LOC_Os10g30700.1 downstream_gene_variant ; 4408.0bp to feature; MODIFIER silent_mutation Average:61.698; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg1015985372 C -> T LOC_Os10g30690.1 intron_variant ; MODIFIER silent_mutation Average:61.698; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg1015985372 C -> DEL N N silent_mutation Average:61.698; most accessible tissue: Minghui63 root, score: 88.829 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1015985372 C T -0.14 -0.06 -0.04 -0.06 -0.12 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015985372 4.85E-06 NA mr1987_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251