\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015982479:

Variant ID: vg1015982479 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15982479
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TTACTTTTGACAAATAGAGGTTCGTTCGGTCTATGATCACATATTTATATGTATAATTTTTGTATGACCAGTAACATTGGCCAAGCAGAGTGTATTTTGG[A/G]
TGAACTGAATGTGTTATTGTACCCTCAAGTACTTTCGTATTTTTCTATACGAAATATTTTTTTTATTTTACTGAAAGCTGGGCTTGAATATATGTTTTTG

Reverse complement sequence

CAAAAACATATATTCAAGCCCAGCTTTCAGTAAAATAAAAAAAATATTTCGTATAGAAAAATACGAAAGTACTTGAGGGTACAATAACACATTCAGTTCA[T/C]
CCAAAATACACTCTGCTTGGCCAATGTTACTGGTCATACAAAAATTATACATATAAATATGTGATCATAGACCGAACGAACCTCTATTTGTCAAAAGTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 0.40% 2.64% 45.37% NA
All Indica  2759 22.70% 0.60% 3.77% 72.96% NA
All Japonica  1512 99.10% 0.00% 0.00% 0.93% NA
Aus  269 69.90% 1.10% 4.46% 24.54% NA
Indica I  595 13.30% 0.20% 4.37% 82.18% NA
Indica II  465 26.00% 1.30% 4.95% 67.74% NA
Indica III  913 18.60% 0.40% 3.18% 77.77% NA
Indica Intermediate  786 32.40% 0.80% 3.31% 63.49% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 59.40% 1.00% 8.33% 31.25% NA
Intermediate  90 75.60% 0.00% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015982479 A -> G LOC_Os10g30680.1 upstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:30.412; most accessible tissue: Callus, score: 70.781 N N N N
vg1015982479 A -> G LOC_Os10g30690.1 upstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:30.412; most accessible tissue: Callus, score: 70.781 N N N N
vg1015982479 A -> G LOC_Os10g30680-LOC_Os10g30690 intergenic_region ; MODIFIER silent_mutation Average:30.412; most accessible tissue: Callus, score: 70.781 N N N N
vg1015982479 A -> DEL N N silent_mutation Average:30.412; most accessible tissue: Callus, score: 70.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015982479 1.62E-14 2.24E-15 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 2.14E-07 2.89E-08 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 6.84E-06 3.78E-07 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 NA 1.95E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 7.28E-06 7.28E-06 mr1945 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 4.73E-07 2.10E-09 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 2.78E-07 1.44E-09 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 7.12E-08 2.96E-10 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 NA 1.19E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479 1.42E-06 1.42E-06 mr1945_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251