\
| Variant ID: vg1015982479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15982479 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 191. )
TTACTTTTGACAAATAGAGGTTCGTTCGGTCTATGATCACATATTTATATGTATAATTTTTGTATGACCAGTAACATTGGCCAAGCAGAGTGTATTTTGG[A/G]
TGAACTGAATGTGTTATTGTACCCTCAAGTACTTTCGTATTTTTCTATACGAAATATTTTTTTTATTTTACTGAAAGCTGGGCTTGAATATATGTTTTTG
CAAAAACATATATTCAAGCCCAGCTTTCAGTAAAATAAAAAAAATATTTCGTATAGAAAAATACGAAAGTACTTGAGGGTACAATAACACATTCAGTTCA[T/C]
CCAAAATACACTCTGCTTGGCCAATGTTACTGGTCATACAAAAATTATACATATAAATATGTGATCATAGACCGAACGAACCTCTATTTGTCAAAAGTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 0.40% | 2.64% | 45.37% | NA |
| All Indica | 2759 | 22.70% | 0.60% | 3.77% | 72.96% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.00% | 0.93% | NA |
| Aus | 269 | 69.90% | 1.10% | 4.46% | 24.54% | NA |
| Indica I | 595 | 13.30% | 0.20% | 4.37% | 82.18% | NA |
| Indica II | 465 | 26.00% | 1.30% | 4.95% | 67.74% | NA |
| Indica III | 913 | 18.60% | 0.40% | 3.18% | 77.77% | NA |
| Indica Intermediate | 786 | 32.40% | 0.80% | 3.31% | 63.49% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 59.40% | 1.00% | 8.33% | 31.25% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015982479 | A -> G | LOC_Os10g30680.1 | upstream_gene_variant ; 1954.0bp to feature; MODIFIER | silent_mutation | Average:30.412; most accessible tissue: Callus, score: 70.781 | N | N | N | N |
| vg1015982479 | A -> G | LOC_Os10g30690.1 | upstream_gene_variant ; 1317.0bp to feature; MODIFIER | silent_mutation | Average:30.412; most accessible tissue: Callus, score: 70.781 | N | N | N | N |
| vg1015982479 | A -> G | LOC_Os10g30680-LOC_Os10g30690 | intergenic_region ; MODIFIER | silent_mutation | Average:30.412; most accessible tissue: Callus, score: 70.781 | N | N | N | N |
| vg1015982479 | A -> DEL | N | N | silent_mutation | Average:30.412; most accessible tissue: Callus, score: 70.781 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015982479 | 1.62E-14 | 2.24E-15 | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 2.14E-07 | 2.89E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 6.84E-06 | 3.78E-07 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | NA | 1.95E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 7.28E-06 | 7.28E-06 | mr1945 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 4.73E-07 | 2.10E-09 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 2.78E-07 | 1.44E-09 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 7.12E-08 | 2.96E-10 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | NA | 1.19E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015982479 | 1.42E-06 | 1.42E-06 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |