\
| Variant ID: vg1015968448 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15968448 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTAAATAATCTATCATTAGCAAATGTTTACTGCAGCACCACATTGTCAAATCATGAAGCAATTAGGCTTGAAAGATTCGTCTCGCAATTTACATACAAT[A/C]
TGTATAATTAGTTATTTTTTATATTATTTAATACTCCATGCATACGTCCAAACATTCGATGTGACAGGGTAAAAAAATTTTGCCCGGGGATCTAAACAGG
CCTGTTTAGATCCCCGGGCAAAATTTTTTTACCCTGTCACATCGAATGTTTGGACGTATGCATGGAGTATTAAATAATATAAAAAATAACTAATTATACA[T/G]
ATTGTATGTAAATTGCGAGACGAATCTTTCAAGCCTAATTGCTTCATGATTTGACAATGTGGTGCTGCAGTAAACATTTGCTAATGATAGATTATTTAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 6.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.70% | 52.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015968448 | A -> C | LOC_Os10g30660.1 | upstream_gene_variant ; 3697.0bp to feature; MODIFIER | silent_mutation | Average:53.396; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg1015968448 | A -> C | LOC_Os10g30670.1 | upstream_gene_variant ; 225.0bp to feature; MODIFIER | silent_mutation | Average:53.396; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg1015968448 | A -> C | LOC_Os10g30660-LOC_Os10g30670 | intergenic_region ; MODIFIER | silent_mutation | Average:53.396; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015968448 | NA | 1.91E-06 | mr1534 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015968448 | 3.30E-09 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015968448 | NA | 1.35E-07 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015968448 | 9.85E-08 | NA | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015968448 | NA | 1.22E-07 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |