\
| Variant ID: vg1015906056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15906056 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATAATAATTTAAGGGTTCTATTTTTCTTAAGGTATCTTAGAAAACCATTCACAAACTTTTGAGTAGAAGATATTTGAGTAGGAGATGGATTAAGTACTTA[T/C]
GATTTTTGAATCATGTTTCTTTTTTCTCGAGTAAATAAGAAACTATTGCTAGTTAATTATCATATAGTCCATCTATATACATACCGTGTAGTATGGCCGC
GCGGCCATACTACACGGTATGTATATAGATGGACTATATGATAATTAACTAGCAATAGTTTCTTATTTACTCGAGAAAAAAGAAACATGATTCAAAAATC[A/G]
TAAGTACTTAATCCATCTCCTACTCAAATATCTTCTACTCAAAAGTTTGTGAATGGTTTTCTAAGATACCTTAAGAAAAATAGAACCCTTAAATTATTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.50% | 0.40% | 11.00% | 56.12% | NA |
| All Indica | 2759 | 20.60% | 0.70% | 15.30% | 63.47% | NA |
| All Japonica | 1512 | 50.90% | 0.00% | 1.39% | 47.75% | NA |
| Aus | 269 | 39.80% | 0.00% | 19.70% | 40.52% | NA |
| Indica I | 595 | 19.30% | 0.00% | 14.79% | 65.88% | NA |
| Indica II | 465 | 16.80% | 2.20% | 21.08% | 60.00% | NA |
| Indica III | 913 | 22.70% | 0.00% | 12.49% | 64.84% | NA |
| Indica Intermediate | 786 | 21.20% | 1.10% | 15.52% | 62.09% | NA |
| Temperate Japonica | 767 | 88.00% | 0.00% | 0.26% | 11.73% | NA |
| Tropical Japonica | 504 | 3.40% | 0.00% | 2.18% | 94.44% | NA |
| Japonica Intermediate | 241 | 32.00% | 0.00% | 3.32% | 64.73% | NA |
| VI/Aromatic | 96 | 55.20% | 0.00% | 14.58% | 30.21% | NA |
| Intermediate | 90 | 43.30% | 0.00% | 11.11% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015906056 | T -> C | LOC_Os10g30560.1 | upstream_gene_variant ; 3129.0bp to feature; MODIFIER | silent_mutation | Average:13.171; most accessible tissue: Callus, score: 51.454 | N | N | N | N |
| vg1015906056 | T -> C | LOC_Os10g30560-LOC_Os10g30580 | intergenic_region ; MODIFIER | silent_mutation | Average:13.171; most accessible tissue: Callus, score: 51.454 | N | N | N | N |
| vg1015906056 | T -> DEL | N | N | silent_mutation | Average:13.171; most accessible tissue: Callus, score: 51.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015906056 | NA | 5.63E-07 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | 3.55E-06 | NA | mr1149_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | NA | 2.83E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | NA | 5.52E-08 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | NA | 2.52E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | NA | 3.15E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | NA | 8.36E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015906056 | NA | 6.56E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |