\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015906056:

Variant ID: vg1015906056 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15906056
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATAATTTAAGGGTTCTATTTTTCTTAAGGTATCTTAGAAAACCATTCACAAACTTTTGAGTAGAAGATATTTGAGTAGGAGATGGATTAAGTACTTA[T/C]
GATTTTTGAATCATGTTTCTTTTTTCTCGAGTAAATAAGAAACTATTGCTAGTTAATTATCATATAGTCCATCTATATACATACCGTGTAGTATGGCCGC

Reverse complement sequence

GCGGCCATACTACACGGTATGTATATAGATGGACTATATGATAATTAACTAGCAATAGTTTCTTATTTACTCGAGAAAAAAGAAACATGATTCAAAAATC[A/G]
TAAGTACTTAATCCATCTCCTACTCAAATATCTTCTACTCAAAAGTTTGTGAATGGTTTTCTAAGATACCTTAAGAAAAATAGAACCCTTAAATTATTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.50% 0.40% 11.00% 56.12% NA
All Indica  2759 20.60% 0.70% 15.30% 63.47% NA
All Japonica  1512 50.90% 0.00% 1.39% 47.75% NA
Aus  269 39.80% 0.00% 19.70% 40.52% NA
Indica I  595 19.30% 0.00% 14.79% 65.88% NA
Indica II  465 16.80% 2.20% 21.08% 60.00% NA
Indica III  913 22.70% 0.00% 12.49% 64.84% NA
Indica Intermediate  786 21.20% 1.10% 15.52% 62.09% NA
Temperate Japonica  767 88.00% 0.00% 0.26% 11.73% NA
Tropical Japonica  504 3.40% 0.00% 2.18% 94.44% NA
Japonica Intermediate  241 32.00% 0.00% 3.32% 64.73% NA
VI/Aromatic  96 55.20% 0.00% 14.58% 30.21% NA
Intermediate  90 43.30% 0.00% 11.11% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015906056 T -> C LOC_Os10g30560.1 upstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:13.171; most accessible tissue: Callus, score: 51.454 N N N N
vg1015906056 T -> C LOC_Os10g30560-LOC_Os10g30580 intergenic_region ; MODIFIER silent_mutation Average:13.171; most accessible tissue: Callus, score: 51.454 N N N N
vg1015906056 T -> DEL N N silent_mutation Average:13.171; most accessible tissue: Callus, score: 51.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015906056 NA 5.63E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 3.55E-06 NA mr1149_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 NA 2.83E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 NA 5.52E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 NA 2.52E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 NA 3.15E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 NA 8.36E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015906056 NA 6.56E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251