\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015868542:

Variant ID: vg1015868542 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15868542
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, C: 0.19, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCCACGGTAGAGGCTGTTTCTACCCTATTTAATACGTACCGCGACCCAGCGTGAGGGAATCGCGTTCCATCTAGTTTTCCTATAGTCGGCATGGATGG[A/C]
GTCGTTGCCCTTGCGCGGCCCGCCGGCGAAGGAGAAGAGCCAGGGCCGCGCCGCTGCGCGCACCCGGCGCTGCCACGCGGCCACGGCGGCGGCGGTCTCC

Reverse complement sequence

GGAGACCGCCGCCGCCGTGGCCGCGTGGCAGCGCCGGGTGCGCGCAGCGGCGCGGCCCTGGCTCTTCTCCTTCGCCGGCGGGCCGCGCAAGGGCAACGAC[T/G]
CCATCCATGCCGACTATAGGAAAACTAGATGGAACGCGATTCCCTCACGCTGGGTCGCGGTACGTATTAAATAGGGTAGAAACAGCCTCTACCGTGGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 22.00% 1.12% 9.63% NA
All Indica  2759 98.40% 1.00% 0.18% 0.40% NA
All Japonica  1512 4.60% 65.50% 1.39% 28.57% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.00% 1.70% 0.43% 0.86% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 1.90% 0.38% 0.89% NA
Temperate Japonica  767 1.30% 96.20% 0.00% 2.48% NA
Tropical Japonica  504 6.20% 16.50% 3.57% 73.81% NA
Japonica Intermediate  241 11.60% 70.10% 1.24% 17.01% NA
VI/Aromatic  96 72.90% 2.10% 23.96% 1.04% NA
Intermediate  90 63.30% 21.10% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015868542 A -> C LOC_Os10g30520.1 upstream_gene_variant ; 750.0bp to feature; MODIFIER silent_mutation Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1015868542 A -> C LOC_Os10g30510.1 downstream_gene_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1015868542 A -> C LOC_Os10g30510-LOC_Os10g30520 intergenic_region ; MODIFIER silent_mutation Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1015868542 A -> DEL N N silent_mutation Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015868542 NA 5.20E-11 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 3.27E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 2.18E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 4.37E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 3.15E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 7.36E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 1.26E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 2.48E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 1.82E-08 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 1.07E-44 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 1.13E-40 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 1.08E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 4.22E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 8.84E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 2.36E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 8.29E-07 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 2.83E-42 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 4.07E-46 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 9.04E-15 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 2.00E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 2.12E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015868542 NA 3.18E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251