\
| Variant ID: vg1015868542 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15868542 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, C: 0.19, others allele: 0.00, population size: 90. )
TCGCCACGGTAGAGGCTGTTTCTACCCTATTTAATACGTACCGCGACCCAGCGTGAGGGAATCGCGTTCCATCTAGTTTTCCTATAGTCGGCATGGATGG[A/C]
GTCGTTGCCCTTGCGCGGCCCGCCGGCGAAGGAGAAGAGCCAGGGCCGCGCCGCTGCGCGCACCCGGCGCTGCCACGCGGCCACGGCGGCGGCGGTCTCC
GGAGACCGCCGCCGCCGTGGCCGCGTGGCAGCGCCGGGTGCGCGCAGCGGCGCGGCCCTGGCTCTTCTCCTTCGCCGGCGGGCCGCGCAAGGGCAACGAC[T/G]
CCATCCATGCCGACTATAGGAAAACTAGATGGAACGCGATTCCCTCACGCTGGGTCGCGGTACGTATTAAATAGGGTAGAAACAGCCTCTACCGTGGCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 22.00% | 1.12% | 9.63% | NA |
| All Indica | 2759 | 98.40% | 1.00% | 0.18% | 0.40% | NA |
| All Japonica | 1512 | 4.60% | 65.50% | 1.39% | 28.57% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 1.70% | 0.43% | 0.86% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 1.90% | 0.38% | 0.89% | NA |
| Temperate Japonica | 767 | 1.30% | 96.20% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 6.20% | 16.50% | 3.57% | 73.81% | NA |
| Japonica Intermediate | 241 | 11.60% | 70.10% | 1.24% | 17.01% | NA |
| VI/Aromatic | 96 | 72.90% | 2.10% | 23.96% | 1.04% | NA |
| Intermediate | 90 | 63.30% | 21.10% | 4.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015868542 | A -> C | LOC_Os10g30520.1 | upstream_gene_variant ; 750.0bp to feature; MODIFIER | silent_mutation | Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 | N | N | N | N |
| vg1015868542 | A -> C | LOC_Os10g30510.1 | downstream_gene_variant ; 210.0bp to feature; MODIFIER | silent_mutation | Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 | N | N | N | N |
| vg1015868542 | A -> C | LOC_Os10g30510-LOC_Os10g30520 | intergenic_region ; MODIFIER | silent_mutation | Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 | N | N | N | N |
| vg1015868542 | A -> DEL | N | N | silent_mutation | Average:73.052; most accessible tissue: Zhenshan97 root, score: 82.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015868542 | NA | 5.20E-11 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 3.27E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 2.18E-07 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 4.37E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 3.15E-09 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 7.36E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 1.26E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 2.48E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | 1.82E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 1.07E-44 | mr1771 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 1.13E-40 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 1.08E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 4.22E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 8.84E-13 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 2.36E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | 8.29E-07 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 2.83E-42 | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 4.07E-46 | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 9.04E-15 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 2.00E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 2.12E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015868542 | NA | 3.18E-39 | mr1862_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |