\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015857367:

Variant ID: vg1015857367 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15857367
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TATCCTCTGGTGGTACTCTATCCGTCTCATAAAAAAAAACCTAGTATTAGATGTGATATATCCTAGTTCTACGAATCAAGATATACATCTGTTCAGATTT[A/G]
TTGTACTAGAATATGTCACATCCAGTTCTAAAAAAAATTTGGATGGATAGAGTAGGTGATAGGTGATTTTAGTACCACGCCTTTATCTGTTGCGCGCACA

Reverse complement sequence

TGTGCGCGCAACAGATAAAGGCGTGGTACTAAAATCACCTATCACCTACTCTATCCATCCAAATTTTTTTTAGAACTGGATGTGACATATTCTAGTACAA[T/C]
AAATCTGAACAGATGTATATCTTGATTCGTAGAACTAGGATATATCACATCTAATACTAGGTTTTTTTTTATGAGACGGATAGAGTACCACCAGAGGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 18.80% 0.93% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 42.70% 54.50% 2.84% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 10.70% 88.80% 0.52% 0.00% NA
Tropical Japonica  504 78.60% 14.50% 6.94% 0.00% NA
Japonica Intermediate  241 69.30% 29.00% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015857367 A -> G LOC_Os10g30490.1 upstream_gene_variant ; 2513.0bp to feature; MODIFIER silent_mutation Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1015857367 A -> G LOC_Os10g30480.1 downstream_gene_variant ; 815.0bp to feature; MODIFIER silent_mutation Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1015857367 A -> G LOC_Os10g30500.1 downstream_gene_variant ; 3981.0bp to feature; MODIFIER silent_mutation Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1015857367 A -> G LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015857367 NA 3.07E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 8.99E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 6.36E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 8.40E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 9.31E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 6.09E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 2.76E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 5.60E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 5.58E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 2.93E-14 mr1722_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367 NA 6.83E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251