\
| Variant ID: vg1015857367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15857367 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 111. )
TATCCTCTGGTGGTACTCTATCCGTCTCATAAAAAAAAACCTAGTATTAGATGTGATATATCCTAGTTCTACGAATCAAGATATACATCTGTTCAGATTT[A/G]
TTGTACTAGAATATGTCACATCCAGTTCTAAAAAAAATTTGGATGGATAGAGTAGGTGATAGGTGATTTTAGTACCACGCCTTTATCTGTTGCGCGCACA
TGTGCGCGCAACAGATAAAGGCGTGGTACTAAAATCACCTATCACCTACTCTATCCATCCAAATTTTTTTTAGAACTGGATGTGACATATTCTAGTACAA[T/C]
AAATCTGAACAGATGTATATCTTGATTCGTAGAACTAGGATATATCACATCTAATACTAGGTTTTTTTTTATGAGACGGATAGAGTACCACCAGAGGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.30% | 18.80% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 42.70% | 54.50% | 2.84% | 0.00% | NA |
| Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.70% | 88.80% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 14.50% | 6.94% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.30% | 29.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015857367 | A -> G | LOC_Os10g30490.1 | upstream_gene_variant ; 2513.0bp to feature; MODIFIER | silent_mutation | Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1015857367 | A -> G | LOC_Os10g30480.1 | downstream_gene_variant ; 815.0bp to feature; MODIFIER | silent_mutation | Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1015857367 | A -> G | LOC_Os10g30500.1 | downstream_gene_variant ; 3981.0bp to feature; MODIFIER | silent_mutation | Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1015857367 | A -> G | LOC_Os10g30460-LOC_Os10g30480 | intergenic_region ; MODIFIER | silent_mutation | Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015857367 | NA | 3.07E-29 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 8.99E-06 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 6.36E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 8.40E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 9.31E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 6.09E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 2.76E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 5.60E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 5.58E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 2.93E-14 | mr1722_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015857367 | NA | 6.83E-06 | mr1722_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |