Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015857367:

Variant ID: vg1015857367 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15857367
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TATCCTCTGGTGGTACTCTATCCGTCTCATAAAAAAAAACCTAGTATTAGATGTGATATATCCTAGTTCTACGAATCAAGATATACATCTGTTCAGATTT[A/G]
TTGTACTAGAATATGTCACATCCAGTTCTAAAAAAAATTTGGATGGATAGAGTAGGTGATAGGTGATTTTAGTACCACGCCTTTATCTGTTGCGCGCACA

Reverse complement sequence

TGTGCGCGCAACAGATAAAGGCGTGGTACTAAAATCACCTATCACCTACTCTATCCATCCAAATTTTTTTTAGAACTGGATGTGACATATTCTAGTACAA[T/C]
AAATCTGAACAGATGTATATCTTGATTCGTAGAACTAGGATATATCACATCTAATACTAGGTTTTTTTTTATGAGACGGATAGAGTACCACCAGAGGATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.30%	18.80%	0.93%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	42.70%	54.50%	2.84%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.40%	0.00%	0.00%	NA
Temperate Japonica	767	10.70%	88.80%	0.52%	0.00%	NA
Tropical Japonica	504	78.60%	14.50%	6.94%	0.00%	NA
Japonica Intermediate	241	69.30%	29.00%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015857367	A -> G	LOC_Os10g30490.1	upstream_gene_variant ; 2513.0bp to feature; MODIFIER	silent_mutation	Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1015857367	A -> G	LOC_Os10g30480.1	downstream_gene_variant ; 815.0bp to feature; MODIFIER	silent_mutation	Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1015857367	A -> G	LOC_Os10g30500.1	downstream_gene_variant ; 3981.0bp to feature; MODIFIER	silent_mutation	Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1015857367	A -> G	LOC_Os10g30460-LOC_Os10g30480	intergenic_region ; MODIFIER	silent_mutation	Average:67.969; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015857367	NA	3.07E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	8.99E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	6.36E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	8.40E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	9.31E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	6.09E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	2.76E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	5.60E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	5.58E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	2.93E-14	mr1722_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015857367	NA	6.83E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251