\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015855481:

Variant ID: vg1015855481 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15855481
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCGTCCGAACTCAATCCAATATTTTGTACCTTTTCCTCCCAAGAATCGTGGCCAGATATTTTTTTAACGAATCGACGAGCGCCAATTTTATTGAATA[A/G,T]
AGAAGGAGAACTTTACAAAGCGAAAGGAAAAAAGAAAGGAGCTAGGACCTTTGGTCCAAGCTAACTTAAAAAAACCAACTATTAAAACTTCTCGCTCCTG

Reverse complement sequence

CAGGAGCGAGAAGTTTTAATAGTTGGTTTTTTTAAGTTAGCTTGGACCAAAGGTCCTAGCTCCTTTCTTTTTTCCTTTCGCTTTGTAAAGTTCTCCTTCT[T/C,A]
TATTCAATAAAATTGGCGCTCGTCGATTCGTTAAAAAAATATCTGGCCACGATTCTTGGGAGGAAAAGGTACAAAATATTGGATTGAGTTCGGACGAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 22.00% 0.19% 10.64% T: 0.11%
All Indica  2759 98.40% 0.90% 0.04% 0.54% T: 0.07%
All Japonica  1512 4.50% 65.70% 0.20% 29.56% NA
Aus  269 97.80% 0.40% 1.49% 0.37% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.20% 1.70% 0.00% 1.08% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 1.80% 0.13% 1.27% T: 0.25%
Temperate Japonica  767 1.20% 96.30% 0.00% 2.48% NA
Tropical Japonica  504 6.30% 16.90% 0.40% 76.39% NA
Japonica Intermediate  241 11.20% 70.50% 0.41% 17.84% NA
VI/Aromatic  96 71.90% 2.10% 0.00% 26.04% NA
Intermediate  90 57.80% 21.10% 1.11% 16.67% T: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015855481 A -> G LOC_Os10g30490.1 upstream_gene_variant ; 4399.0bp to feature; MODIFIER silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg1015855481 A -> G LOC_Os10g30480.1 downstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg1015855481 A -> G LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg1015855481 A -> T LOC_Os10g30490.1 upstream_gene_variant ; 4399.0bp to feature; MODIFIER silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg1015855481 A -> T LOC_Os10g30480.1 downstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg1015855481 A -> T LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg1015855481 A -> DEL N N silent_mutation Average:58.629; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015855481 NA 5.77E-10 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 5.12E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 8.23E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 3.90E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 6.62E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 4.35E-06 NA mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 1.62E-06 5.84E-09 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 5.89E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 4.25E-22 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 2.62E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 4.16E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.15E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 2.12E-17 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 5.00E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 2.43E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 9.78E-49 mr1771 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 2.07E-40 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 4.63E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.48E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.46E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 9.85E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.27E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.68E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 8.81E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 3.49E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.39E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 3.98E-40 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 2.12E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.95E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 8.24E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 5.49E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.60E-42 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 2.18E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 4.97E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 6.34E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015855481 NA 1.22E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251