\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015837007:

Variant ID: vg1015837007 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15837007
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, A: 0.23, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GAACATGCAACATTTTTGCCATTGACGAACTACATACCGTAGATAGGGAACGCCTCCTTGATAATATTGTTACTGTTTCAGGACATCGGAATGGAATGCT[A/C]
AGCCTTCTACCCCCGCTCCGCACCTATCGTCAATAGCGTCGTCTCATGTTACTTTGTCCTCTTCCTCCACACCCTTCATGCTCCTCTTCCGCCTCTCGCA

Reverse complement sequence

TGCGAGAGGCGGAAGAGGAGCATGAAGGGTGTGGAGGAAGAGGACAAAGTAACATGAGACGACGCTATTGACGATAGGTGCGGAGCGGGGGTAGAAGGCT[T/G]
AGCATTCCATTCCGATGTCCTGAAACAGTAACAATATTATCAAGGAGGCGTTCCCTATCTACGGTATGTAGTTCGTCAATGGCAAAAATGTTGCATGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 16.00% 7.00% 3.36% NA
All Indica  2759 93.50% 6.00% 0.22% 0.25% NA
All Japonica  1512 52.20% 18.80% 21.03% 8.00% NA
Aus  269 16.70% 82.90% 0.37% 0.00% NA
Indica I  595 82.40% 17.60% 0.00% 0.00% NA
Indica II  465 97.20% 1.90% 0.43% 0.43% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 4.50% 0.51% 0.64% NA
Temperate Japonica  767 87.50% 10.00% 2.09% 0.39% NA
Tropical Japonica  504 7.70% 16.70% 54.17% 21.43% NA
Japonica Intermediate  241 32.80% 51.00% 12.03% 4.15% NA
VI/Aromatic  96 5.20% 70.80% 0.00% 23.96% NA
Intermediate  90 65.60% 18.90% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015837007 A -> C LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:64.86; most accessible tissue: Callus, score: 95.238 N N N N
vg1015837007 A -> DEL N N silent_mutation Average:64.86; most accessible tissue: Callus, score: 95.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015837007 NA 3.86E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 6.30E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.80E-10 mr1029 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.63E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 9.41E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 4.94E-12 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 3.57E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.15E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 6.33E-09 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 9.42E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 3.91E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.69E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 4.90E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 7.76E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.38E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.19E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 2.77E-09 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 5.21E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 3.28E-08 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 8.34E-07 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 3.23E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 2.57E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.98E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 5.13E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 8.81E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 7.72E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.74E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 2.97E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.07E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 2.40E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015837007 NA 1.12E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251