\
| Variant ID: vg1015834424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15834424 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )
GCAATCCAGGCATTTAGAAAAATATCTCACCTCTTTTGACATGGAAATAATAAAATAATACAATCGGTGTCCTACTACCAATTATACGTATGTTTAGTAT[C/G,T]
CATCAGCCCTATCACGTTTACATGGTGTCTCCCAACAAATTACATGTTTTTTACGTGTCCTGTGGCAAATTTTGCCATCTAAAAATGCCGAATCATATGA
TCATATGATTCGGCATTTTTAGATGGCAAAATTTGCCACAGGACACGTAAAAAACATGTAATTTGTTGGGAGACACCATGTAAACGTGATAGGGCTGATG[G/C,A]
ATACTAAACATACGTATAATTGGTAGTAGGACACCGATTGTATTATTTTATTATTTCCATGTCAAAAGAGGTGAGATATTTTTCTAAATGCCTGGATTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.70% | 0.02% | 0.00% | T: 0.02% |
| All Indica | 2759 | 99.50% | 0.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 70.10% | 29.80% | 0.00% | 0.00% | T: 0.07% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 23.00% | 77.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.30% | 18.30% | 0.00% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015834424 | C -> G | LOC_Os10g30460.1 | upstream_gene_variant ; 2580.0bp to feature; MODIFIER | silent_mutation | Average:58.666; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| vg1015834424 | C -> G | LOC_Os10g30460-LOC_Os10g30480 | intergenic_region ; MODIFIER | silent_mutation | Average:58.666; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| vg1015834424 | C -> T | LOC_Os10g30460.1 | upstream_gene_variant ; 2580.0bp to feature; MODIFIER | silent_mutation | Average:58.666; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| vg1015834424 | C -> T | LOC_Os10g30460-LOC_Os10g30480 | intergenic_region ; MODIFIER | silent_mutation | Average:58.666; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015834424 | NA | 6.61E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 7.89E-11 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 4.37E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 3.99E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 9.10E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 8.87E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | 1.63E-06 | NA | mr1530 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | 1.16E-06 | 1.21E-08 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 9.39E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 2.30E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 9.85E-08 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 3.94E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 2.68E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 8.37E-14 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 1.34E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 4.92E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 2.30E-30 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 9.84E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 4.24E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015834424 | NA | 1.69E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |