Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015833216:

Variant ID: vg1015833216 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15833216
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTAGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGGTCCTG[T/C]
CACGGCCTCTTTCCGGTATGTCGTGGTGGCATATCGGCGCACGGAAACATGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACACCTCTGATCAGAGTA

Reverse complement sequence

TACTCTGATCAGAGGTGTACAACTGTACCCACAAGACACAGCCCCACGACATGTTTCCGTGCGCCGATATGCCACCACGACATACCGGAAAGAGGCCGTG[A/G]
CAGGACCCTTCGCATAACCCCCTCTAACCAAGCACACCACACCTCAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	5.80%	0.76%	2.29%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	72.90%	17.70%	2.31%	7.01%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	89.20%	9.60%	0.00%	1.17%	NA
Tropical Japonica	504	62.30%	15.10%	6.15%	16.47%	NA
Japonica Intermediate	241	43.60%	49.00%	1.66%	5.81%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015833216	T -> C	LOC_Os10g30460.1	upstream_gene_variant ; 1372.0bp to feature; MODIFIER	silent_mutation	Average:32.471; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg1015833216	T -> C	LOC_Os10g30450.1	downstream_gene_variant ; 4390.0bp to feature; MODIFIER	silent_mutation	Average:32.471; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg1015833216	T -> C	LOC_Os10g30460-LOC_Os10g30480	intergenic_region ; MODIFIER	silent_mutation	Average:32.471; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg1015833216	T -> DEL	N	N	silent_mutation	Average:32.471; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015833216	NA	7.25E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	4.29E-06	1.44E-06	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	9.43E-06	2.52E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	4.42E-06	2.11E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	4.94E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	9.20E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	6.13E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	6.83E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	9.52E-07	4.15E-07	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	2.08E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	1.15E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	8.52E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	8.21E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	6.65E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	6.36E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833216	NA	6.87E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251