Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015811222:

Variant ID: vg1015811222 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15811222
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

AGTACCAGGATGTGTCACATCCAGTACTAGGTTAGTTTTTTATGGGACGGAGGGAGTACACAACTATAGTACACTTTCTATAAGCAGAAGCATGAATAAC[G/C]
CCGCATTTGATTTTATGCCATCCTTAACATGTGAGTGGCTTATAATGTCAGTGAAGAGGGGACCCCTGTTTTTTTTAAGAGAAAGGTGCATCTACATCCA

Reverse complement sequence

TGGATGTAGATGCACCTTTCTCTTAAAAAAAACAGGGGTCCCCTCTTCACTGACATTATAAGCCACTCACATGTTAAGGATGGCATAAAATCAAATGCGG[C/G]
GTTATTCATGCTTCTGCTTATAGAAAGTGTACTATAGTTGTGTACTCCCTCCGTCCCATAAAAAACTAACCTAGTACTGGATGTGACACATCCTGGTACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	22.60%	0.04%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.04%	0.00%	NA
All Japonica	1512	34.50%	65.40%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	83.70%	16.30%	0.00%	0.00%	NA
Japonica Intermediate	241	29.00%	70.50%	0.41%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015811222	G -> C	LOC_Os10g30410.1	upstream_gene_variant ; 204.0bp to feature; MODIFIER	silent_mutation	Average:62.967; most accessible tissue: Callus, score: 82.168	N	N	N	N
vg1015811222	G -> C	LOC_Os10g30420.1	downstream_gene_variant ; 1614.0bp to feature; MODIFIER	silent_mutation	Average:62.967; most accessible tissue: Callus, score: 82.168	N	N	N	N
vg1015811222	G -> C	LOC_Os10g30410-LOC_Os10g30420	intergenic_region ; MODIFIER	silent_mutation	Average:62.967; most accessible tissue: Callus, score: 82.168	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015811222	NA	5.77E-10	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	5.12E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	8.23E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	3.90E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	1.62E-06	5.84E-09	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	5.89E-15	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	3.75E-22	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	2.17E-06	1.15E-11	mr1691	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	4.14E-10	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	4.48E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	2.12E-17	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	5.00E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	6.52E-44	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	2.58E-37	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	1.07E-09	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	1.48E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	1.68E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	9.47E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	1.39E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	2.12E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	8.24E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	6.34E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811222	NA	7.96E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251