\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015811135:

Variant ID: vg1015811135 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 15811135
Reference Allele: GAlternative Allele: A,GAGGTA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACCTCCGTCCTTAAAAAAACGAATCTAAGACTGGATGTGACATATTCTAGTACAATGAATCTGGACAGAGGTTTGTTCAGATTCGTAGTACCAGGATGT[G/A,GAGGTA]
TCACATCCAGTACTAGGTTAGTTTTTTATGGGACGGAGGGAGTACACAACTATAGTACACTTTCTATAAGCAGAAGCATGAATAACGCCGCATTTGATTT

Reverse complement sequence

AAATCAAATGCGGCGTTATTCATGCTTCTGCTTATAGAAAGTGTACTATAGTTGTGTACTCCCTCCGTCCCATAAAAAACTAACCTAGTACTGGATGTGA[C/T,TACCTC]
ACATCCTGGTACTACGAATCTGAACAAACCTCTGTCCAGATTCATTGTACTAGAATATGTCACATCCAGTCTTAGATTCGTTTTTTTAAGGACGGAGGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 22.70% 1.57% 0.00% GAGGTA: 3.36%
All Indica  2759 91.00% 1.10% 2.54% 0.00% GAGGTA: 5.40%
All Japonica  1512 34.40% 65.40% 0.07% 0.00% GAGGTA: 0.13%
Aus  269 99.60% 0.00% 0.00% 0.00% GAGGTA: 0.37%
Indica I  595 93.80% 0.70% 5.38% 0.00% GAGGTA: 0.17%
Indica II  465 80.60% 1.90% 3.87% 0.00% GAGGTA: 13.55%
Indica III  913 96.20% 0.00% 0.44% 0.00% GAGGTA: 3.40%
Indica Intermediate  786 89.10% 2.00% 2.04% 0.00% GAGGTA: 6.87%
Temperate Japonica  767 3.80% 96.10% 0.00% 0.00% GAGGTA: 0.13%
Tropical Japonica  504 83.70% 16.30% 0.00% 0.00% NA
Japonica Intermediate  241 28.60% 70.50% 0.41% 0.00% GAGGTA: 0.41%
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 60.00% 28.90% 3.33% 0.00% GAGGTA: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015811135 G -> GAGGTA LOC_Os10g30410.1 upstream_gene_variant ; 118.0bp to feature; MODIFIER silent_mutation Average:71.42; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1015811135 G -> GAGGTA LOC_Os10g30420.1 downstream_gene_variant ; 1700.0bp to feature; MODIFIER silent_mutation Average:71.42; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1015811135 G -> GAGGTA LOC_Os10g30410-LOC_Os10g30420 intergenic_region ; MODIFIER silent_mutation Average:71.42; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1015811135 G -> A LOC_Os10g30410.1 upstream_gene_variant ; 117.0bp to feature; MODIFIER silent_mutation Average:71.42; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1015811135 G -> A LOC_Os10g30420.1 downstream_gene_variant ; 1701.0bp to feature; MODIFIER silent_mutation Average:71.42; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1015811135 G -> A LOC_Os10g30410-LOC_Os10g30420 intergenic_region ; MODIFIER silent_mutation Average:71.42; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015811135 NA 3.93E-10 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 7.11E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 7.03E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 7.99E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 2.07E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 6.86E-07 2.59E-09 mr1530 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 3.40E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 7.68E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 2.18E-20 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 9.91E-11 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 4.29E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 7.11E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 5.62E-17 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 4.45E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 9.20E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 6.39E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 2.54E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 1.42E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 6.64E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 4.26E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 9.25E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 7.46E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 1.37E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 4.46E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 4.24E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 2.80E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 2.12E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 2.43E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015811135 NA 5.09E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251