\
| Variant ID: vg1015796617 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15796617 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTCAAAGTTACTTCCTTTAAAGTCGATACTTTTGTTCTCAAACCTCTCTGGTTGAAACTCTTCGGCATCATCCCAATATTTTGGGTCTCTGCATATTG[C/T]
CCATGCATTCACAAATACAGTTGTGTCTTTCGGTATGTCGTAGCCCATAACTTTGCATGTCTCTCGGCATTTACGAGGGCCTAAAAGGGGCACTGGGCAG
CTGCCCAGTGCCCCTTTTAGGCCCTCGTAAATGCCGAGAGACATGCAAAGTTATGGGCTACGACATACCGAAAGACACAACTGTATTTGTGAATGCATGG[G/A]
CAATATGCAGAGACCCAAAATATTGGGATGATGCCGAAGAGTTTCAACCAGAGAGGTTTGAGAACAAAAGTATCGACTTTAAAGGAAGTAACTTTGAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 6.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.30% | 18.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 46.40% | 53.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015796617 | C -> T | LOC_Os10g30390.1 | missense_variant ; p.Ala413Thr; MODERATE | nonsynonymous_codon ; A413T | Average:53.639; most accessible tissue: Zhenshan97 flower, score: 79.85 | benign |
0.61 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015796617 | NA | 5.53E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015796617 | NA | 7.43E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015796617 | NA | 5.99E-06 | mr1107 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015796617 | NA | 1.11E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015796617 | NA | 9.23E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015796617 | NA | 8.13E-08 | mr1653 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |