\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015729829:

Variant ID: vg1015729829 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15729829
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGGCCGCCCGTCCCGACTCCCGCGTCCCGACGGCGCACGGGGAATTCTTCCTTCCAACACCCCAGACGCCGCACGCAAGAATCGCCAACCTCTCTCTC[A/G]
CGCGCACCGCGCACACGGCACACGCGGGATTTCCTCCCCTCACCGACACAAACGCAACCGCGCGCCGAGGAAAAACCCCCGGAAAAGCCGCACGTACTCA

Reverse complement sequence

TGAGTACGTGCGGCTTTTCCGGGGGTTTTTCCTCGGCGCGCGGTTGCGTTTGTGTCGGTGAGGGGAGGAAATCCCGCGTGTGCCGTGTGCGCGGTGCGCG[T/C]
GAGAGAGAGGTTGGCGATTCTTGCGTGCGGCGTCTGGGGTGTTGGAAGGAAGAATTCCCCGTGCGCCGTCGGGACGCGGGAGTCGGGACGGGCGGCCGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 28.60% 0.13% 0.00% NA
All Indica  2759 93.30% 6.60% 0.07% 0.00% NA
All Japonica  1512 46.80% 53.10% 0.13% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 81.50% 18.50% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 5.70% 0.25% 0.00% NA
Temperate Japonica  767 80.80% 19.00% 0.13% 0.00% NA
Tropical Japonica  504 7.50% 92.30% 0.20% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015729829 A -> G LOC_Os10g30280.1 upstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:98.892; most accessible tissue: Zhenshan97 flower, score: 99.708 N N N N
vg1015729829 A -> G LOC_Os10g30270.1 downstream_gene_variant ; 2724.0bp to feature; MODIFIER silent_mutation Average:98.892; most accessible tissue: Zhenshan97 flower, score: 99.708 N N N N
vg1015729829 A -> G LOC_Os10g30290.1 downstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:98.892; most accessible tissue: Zhenshan97 flower, score: 99.708 N N N N
vg1015729829 A -> G LOC_Os10g30270-LOC_Os10g30280 intergenic_region ; MODIFIER silent_mutation Average:98.892; most accessible tissue: Zhenshan97 flower, score: 99.708 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1015729829 A G -0.04 -0.04 -0.03 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015729829 NA 2.43E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 3.90E-09 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 1.64E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 2.93E-10 mr1031 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 8.93E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 3.42E-11 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 4.36E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 5.16E-10 mr1056 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 4.64E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 9.17E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 5.97E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 8.48E-07 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 5.26E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 6.46E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 1.98E-07 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 6.58E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 2.32E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 6.91E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 1.09E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 5.98E-06 5.98E-06 mr1796 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 1.39E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 6.09E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 1.10E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 6.14E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 9.76E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 7.12E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 1.45E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015729829 NA 5.80E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251