Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015690639:

Variant ID: vg1015690639 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15690639
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

ATACAGTTTCACGTAAATCAACTTCCCGCAGGTAAGCTCGCTGAAGATTTGCACCTTGCAAGTTTGAACCAGACAATTTAGCTCCCTGAAAAAGTGAAAA[G/A]
GATACTAATTTAGATTTGTCTCGTCTAAATGGCAATTGTTGGAAGAGACAATAAAAACTTTTAGTATATCTTCAGTTTCCATGATGCACAACATGAGAGA

Reverse complement sequence

TCTCTCATGTTGTGCATCATGGAAACTGAAGATATACTAAAAGTTTTTATTGTCTCTTCCAACAATTGCCATTTAGACGAGACAAATCTAAATTAGTATC[C/T]
TTTTCACTTTTTCAGGGAGCTAAATTGTCTGGTTCAAACTTGCAAGGTGCAAATCTTCAGCGAGCTTACCTGCGGGAAGTTGATTTACGTGAAACTGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.50%	0.00%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	56.90%	43.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	81.50%	18.50%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.70%	0.00%	0.00%	NA
Japonica Intermediate	241	26.10%	73.90%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015690639	G -> A	LOC_Os10g30180.1	downstream_gene_variant ; 789.0bp to feature; MODIFIER	silent_mutation	Average:49.124; most accessible tissue: Minghui63 flower, score: 62.973	N	N	N	N
vg1015690639	G -> A	LOC_Os10g30190.1	intron_variant ; MODIFIER	silent_mutation	Average:49.124; most accessible tissue: Minghui63 flower, score: 62.973	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015690639	NA	1.92E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	8.33E-09	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	6.87E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	2.10E-08	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	7.48E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	2.43E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	3.85E-09	mr1295	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	1.04E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	2.09E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	1.70E-13	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	1.83E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015690639	NA	4.56E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251