\
| Variant ID: vg1015690639 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15690639 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
ATACAGTTTCACGTAAATCAACTTCCCGCAGGTAAGCTCGCTGAAGATTTGCACCTTGCAAGTTTGAACCAGACAATTTAGCTCCCTGAAAAAGTGAAAA[G/A]
GATACTAATTTAGATTTGTCTCGTCTAAATGGCAATTGTTGGAAGAGACAATAAAAACTTTTAGTATATCTTCAGTTTCCATGATGCACAACATGAGAGA
TCTCTCATGTTGTGCATCATGGAAACTGAAGATATACTAAAAGTTTTTATTGTCTCTTCCAACAATTGCCATTTAGACGAGACAAATCTAAATTAGTATC[C/T]
TTTTCACTTTTTCAGGGAGCTAAATTGTCTGGTTCAAACTTGCAAGGTGCAAATCTTCAGCGAGCTTACCTGCGGGAAGTTGATTTACGTGAAACTGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.10% | 73.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015690639 | G -> A | LOC_Os10g30180.1 | downstream_gene_variant ; 789.0bp to feature; MODIFIER | silent_mutation | Average:49.124; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg1015690639 | G -> A | LOC_Os10g30190.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.124; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015690639 | NA | 1.92E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 8.33E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 6.87E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 2.10E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 7.48E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 2.43E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 3.85E-09 | mr1295 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 1.04E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 2.09E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 1.70E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 1.83E-19 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015690639 | NA | 4.56E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |