\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015670808:

Variant ID: vg1015670808 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 15670808
Reference Allele: CAlternative Allele: G,CGTG
Primary Allele: GSecondary Allele: CGTG

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.09, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGCAAGGATCTGGTTTCCTCATGCCAAAAAATAATGGACATGCTATATTTATGGCGACACAAAATTAGCTTGATCACAGTCGGTTAATCTGACCCTT[C/G,CGTG]
GATATCATGTAGATTCGTGTTGCACTTTAATGCTTGACTTAACGAACGTTTGATTTGCTAAGTCCGTAGTTATTTGATCTCTCTGTACTACGAACATGTT

Reverse complement sequence

AACATGTTCGTAGTACAGAGAGATCAAATAACTACGGACTTAGCAAATCAAACGTTCGTTAAGTCAAGCATTAAAGTGCAACACGAATCTACATGATATC[G/C,CACG]
AAGGGTCAGATTAACCGACTGTGATCAAGCTAATTTTGTGTCGCCATAAATATAGCATGTCCATTATTTTTTGGCATGAGGAAACCAGATCCTTGCTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of CGTG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.30% 16.00% 0.11% 0.00% C: 13.61%
All Indica  2759 98.80% 0.60% 0.04% 0.00% C: 0.58%
All Japonica  1512 11.80% 47.40% 0.13% 0.00% C: 40.67%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.00% 0.00% 0.00% C: 0.84%
Indica II  465 97.60% 1.10% 0.22% 0.00% C: 1.08%
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.40% 0.00% 0.00% C: 0.76%
Temperate Japonica  767 1.60% 21.60% 0.00% 0.00% C: 76.79%
Tropical Japonica  504 26.00% 72.80% 0.40% 0.00% C: 0.79%
Japonica Intermediate  241 14.50% 76.30% 0.00% 0.00% C: 9.13%
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 66.70% 17.80% 2.22% 0.00% C: 13.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015670808 C -> G LOC_Os10g30156.1 upstream_gene_variant ; 2320.0bp to feature; MODIFIER silent_mutation Average:75.359; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N
vg1015670808 C -> G LOC_Os10g30150-LOC_Os10g30156 intergenic_region ; MODIFIER silent_mutation Average:75.359; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N
vg1015670808 C -> CGTG LOC_Os10g30156.1 upstream_gene_variant ; 2319.0bp to feature; MODIFIER silent_mutation Average:75.359; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N
vg1015670808 C -> CGTG LOC_Os10g30150-LOC_Os10g30156 intergenic_region ; MODIFIER silent_mutation Average:75.359; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1015670808 C CGTG -0.32 -0.56 -0.46 -0.27 -0.4 -0.33
vg1015670808 C G -0.08 -0.16 -0.15 -0.02 -0.1 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015670808 NA 9.23E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 9.44E-06 1.07E-28 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 3.88E-29 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 2.75E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 4.44E-19 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 2.95E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.10E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.17E-48 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 2.17E-73 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 3.61E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 3.54E-06 2.69E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 2.47E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 4.78E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.59E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 4.15E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 1.90E-06 2.46E-32 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.28E-52 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 2.23E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 2.04E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.28E-28 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 4.75E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 4.63E-08 3.10E-25 mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.20E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015670808 NA 1.56E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251