Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015657131:

Variant ID: vg1015657131 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15657131
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, G: 0.49, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGCAATGTGGATTTGTAGAAATGATGTGGTCTTCAATGGCTCCAATTTTAACTCTTACTTGCATGTTATTTTCAGGGGGACGTATTGGGCTCGACAAT[A/G]
GTCCTTGCTGCTTAAAGAAGATGAGCGCGATGTGATGAAGGAAGGATGCAAATTGTTAGAGACATCTGTCATGCACTTCTTTGGTAAAGATGGATGGAAC

Reverse complement sequence

GTTCCATCCATCTTTACCAAAGAAGTGCATGACAGATGTCTCTAACAATTTGCATCCTTCCTTCATCACATCGCGCTCATCTTCTTTAAGCAGCAAGGAC[T/C]
ATTGTCGAGCCCAATACGTCCCCCTGAAAATAACATGCAAGTAAGAGTTAAAATTGGAGCCATTGAAGACCACATCATTTCTACAAATCCACATTGCCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	32.50%	0.70%	0.00%	NA
All Indica	2759	94.40%	4.50%	1.09%	0.00%	NA
All Japonica	1512	9.30%	90.60%	0.07%	0.00%	NA
Aus	269	98.10%	1.50%	0.37%	0.00%	NA
Indica I	595	92.90%	5.40%	1.68%	0.00%	NA
Indica II	465	93.50%	5.60%	0.86%	0.00%	NA
Indica III	913	96.60%	2.80%	0.55%	0.00%	NA
Indica Intermediate	786	93.40%	5.20%	1.40%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	20.40%	79.60%	0.00%	0.00%	NA
Japonica Intermediate	241	11.20%	88.40%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015657131	A -> G	LOC_Os10g30140.1	upstream_gene_variant ; 2347.0bp to feature; MODIFIER	silent_mutation	Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg1015657131	A -> G	LOC_Os10g30130.1	downstream_gene_variant ; 707.0bp to feature; MODIFIER	silent_mutation	Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg1015657131	A -> G	LOC_Os10g30130-LOC_Os10g30140	intergenic_region ; MODIFIER	silent_mutation	Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015657131	1.89E-06	1.89E-06	mr1008	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	2.53E-07	2.53E-07	mr1009	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	NA	7.75E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	NA	7.89E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	NA	4.22E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	NA	1.85E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	NA	5.16E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131	NA	3.63E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251