\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015657131:

Variant ID: vg1015657131 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15657131
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, G: 0.49, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGCAATGTGGATTTGTAGAAATGATGTGGTCTTCAATGGCTCCAATTTTAACTCTTACTTGCATGTTATTTTCAGGGGGACGTATTGGGCTCGACAAT[A/G]
GTCCTTGCTGCTTAAAGAAGATGAGCGCGATGTGATGAAGGAAGGATGCAAATTGTTAGAGACATCTGTCATGCACTTCTTTGGTAAAGATGGATGGAAC

Reverse complement sequence

GTTCCATCCATCTTTACCAAAGAAGTGCATGACAGATGTCTCTAACAATTTGCATCCTTCCTTCATCACATCGCGCTCATCTTCTTTAAGCAGCAAGGAC[T/C]
ATTGTCGAGCCCAATACGTCCCCCTGAAAATAACATGCAAGTAAGAGTTAAAATTGGAGCCATTGAAGACCACATCATTTCTACAAATCCACATTGCCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 32.50% 0.70% 0.00% NA
All Indica  2759 94.40% 4.50% 1.09% 0.00% NA
All Japonica  1512 9.30% 90.60% 0.07% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 92.90% 5.40% 1.68% 0.00% NA
Indica II  465 93.50% 5.60% 0.86% 0.00% NA
Indica III  913 96.60% 2.80% 0.55% 0.00% NA
Indica Intermediate  786 93.40% 5.20% 1.40% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 20.40% 79.60% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015657131 A -> G LOC_Os10g30140.1 upstream_gene_variant ; 2347.0bp to feature; MODIFIER silent_mutation Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg1015657131 A -> G LOC_Os10g30130.1 downstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg1015657131 A -> G LOC_Os10g30130-LOC_Os10g30140 intergenic_region ; MODIFIER silent_mutation Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015657131 1.89E-06 1.89E-06 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 2.53E-07 2.53E-07 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 NA 7.75E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 NA 7.89E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 NA 4.22E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 NA 1.85E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 NA 5.16E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015657131 NA 3.63E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251