\
| Variant ID: vg1015657131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15657131 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, G: 0.49, others allele: 0.00, population size: 99. )
TGGGCAATGTGGATTTGTAGAAATGATGTGGTCTTCAATGGCTCCAATTTTAACTCTTACTTGCATGTTATTTTCAGGGGGACGTATTGGGCTCGACAAT[A/G]
GTCCTTGCTGCTTAAAGAAGATGAGCGCGATGTGATGAAGGAAGGATGCAAATTGTTAGAGACATCTGTCATGCACTTCTTTGGTAAAGATGGATGGAAC
GTTCCATCCATCTTTACCAAAGAAGTGCATGACAGATGTCTCTAACAATTTGCATCCTTCCTTCATCACATCGCGCTCATCTTCTTTAAGCAGCAAGGAC[T/C]
ATTGTCGAGCCCAATACGTCCCCCTGAAAATAACATGCAAGTAAGAGTTAAAATTGGAGCCATTGAAGACCACATCATTTCTACAAATCCACATTGCCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 32.50% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 94.40% | 4.50% | 1.09% | 0.00% | NA |
| All Japonica | 1512 | 9.30% | 90.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.90% | 5.40% | 1.68% | 0.00% | NA |
| Indica II | 465 | 93.50% | 5.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 96.60% | 2.80% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 5.20% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 20.40% | 79.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.20% | 88.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015657131 | A -> G | LOC_Os10g30140.1 | upstream_gene_variant ; 2347.0bp to feature; MODIFIER | silent_mutation | Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg1015657131 | A -> G | LOC_Os10g30130.1 | downstream_gene_variant ; 707.0bp to feature; MODIFIER | silent_mutation | Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg1015657131 | A -> G | LOC_Os10g30130-LOC_Os10g30140 | intergenic_region ; MODIFIER | silent_mutation | Average:22.094; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015657131 | 1.89E-06 | 1.89E-06 | mr1008 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | 2.53E-07 | 2.53E-07 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | NA | 7.75E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | NA | 7.89E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | NA | 4.22E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | NA | 1.85E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | NA | 5.16E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015657131 | NA | 3.63E-32 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |