Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015507336:

Variant ID: vg1015507336 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15507336
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

GCACCACGGATGTCATAAAAATTGATAACATGGATGCACAAGTGTTTAAAGCTCTGCTTGTTTTTATCTACACGGACACTTGGCCAGAGATAGATCAAGA[T/C]
GAGACGACTATGGTTCAACTACTCGTTGCAGCCAATAAGTATAGCCTATCAAGACTGAAGATAATGTGCGAAGATAGGTTGTGCAGCTATATTGATACAA

Reverse complement sequence

TTGTATCAATATAGCTGCACAACCTATCTTCGCACATTATCTTCAGTCTTGATAGGCTATACTTATTGGCTGCAACGAGTAGTTGAACCATAGTCGTCTC[A/G]
TCTTGATCTATCTCTGGCCAAGTGTCCGTGTAGATAAAAACAAGCAGAGCTTTAAACACTTGTGCATCCATGTTATCAATTTTTATGACATCCGTGGTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	28.60%	0.00%	0.21%	NA
All Indica	2759	98.60%	1.10%	0.00%	0.29%	NA
All Japonica	1512	15.10%	84.90%	0.00%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.00%	0.17%	NA
Indica II	465	97.60%	2.20%	0.00%	0.22%	NA
Indica III	913	99.80%	0.00%	0.00%	0.22%	NA
Indica Intermediate	786	97.50%	2.00%	0.00%	0.51%	NA
Temperate Japonica	767	17.90%	82.10%	0.00%	0.00%	NA
Tropical Japonica	504	13.10%	86.70%	0.00%	0.20%	NA
Japonica Intermediate	241	10.40%	89.60%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015507336	T -> C	LOC_Os10g29840.1	synonymous_variant ; p.Asp256Asp; LOW	synonymous_codon	Average:49.974; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1015507336	T -> DEL	LOC_Os10g29840.1	N	frameshift_variant	Average:49.974; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015507336	NA	1.57E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1015507336	NA	2.14E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	2.84E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	1.89E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	2.13E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	5.60E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	8.43E-14	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	4.27E-21	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	8.99E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	4.88E-07	mr1149_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	8.54E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	2.13E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	1.01E-15	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	7.20E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	1.11E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	9.61E-07	NA	mr1594_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	1.12E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	1.35E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336	NA	6.48E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251