\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015507336:

Variant ID: vg1015507336 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15507336
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


GCACCACGGATGTCATAAAAATTGATAACATGGATGCACAAGTGTTTAAAGCTCTGCTTGTTTTTATCTACACGGACACTTGGCCAGAGATAGATCAAGA[T/C]
GAGACGACTATGGTTCAACTACTCGTTGCAGCCAATAAGTATAGCCTATCAAGACTGAAGATAATGTGCGAAGATAGGTTGTGCAGCTATATTGATACAA

Reverse complement sequence

TTGTATCAATATAGCTGCACAACCTATCTTCGCACATTATCTTCAGTCTTGATAGGCTATACTTATTGGCTGCAACGAGTAGTTGAACCATAGTCGTCTC[A/G]
TCTTGATCTATCTCTGGCCAAGTGTCCGTGTAGATAAAAACAAGCAGAGCTTTAAACACTTGTGCATCCATGTTATCAATTTTTATGACATCCGTGGTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 28.60% 0.00% 0.21% NA
All Indica  2759 98.60% 1.10% 0.00% 0.29% NA
All Japonica  1512 15.10% 84.90% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.00% 0.17% NA
Indica II  465 97.60% 2.20% 0.00% 0.22% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 97.50% 2.00% 0.00% 0.51% NA
Temperate Japonica  767 17.90% 82.10% 0.00% 0.00% NA
Tropical Japonica  504 13.10% 86.70% 0.00% 0.20% NA
Japonica Intermediate  241 10.40% 89.60% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015507336 T -> C LOC_Os10g29840.1 synonymous_variant ; p.Asp256Asp; LOW synonymous_codon Average:49.974; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1015507336 T -> DEL LOC_Os10g29840.1 N frameshift_variant Average:49.974; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015507336 NA 1.57E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1015507336 NA 2.14E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 2.84E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 1.89E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 2.13E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 5.60E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 8.43E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 4.27E-21 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 8.99E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 4.88E-07 mr1149_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 8.54E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 2.13E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 1.01E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 7.20E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 1.11E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 9.61E-07 NA mr1594_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 1.12E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 1.35E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015507336 NA 6.48E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251