Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015460096:

Variant ID: vg1015460096 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15460096
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGTAAATTGCTTTGTACAAACTTATTTCTTTTCGCCGTAGCTTAGCTTGTTAGTTTGTTTAAATGGTTATGTAGCCATCTTAAATTATCATTTTAATA[C/T]
GTCAACTACACTACTTAAGGGGGCTCTTCACACTTTTTCTTTCTTTTTTCTTAAAACAAAAACTATTGCACAACTATGGCACTATCCTAACATTTGCCTA

Reverse complement sequence

TAGGCAAATGTTAGGATAGTGCCATAGTTGTGCAATAGTTTTTGTTTTAAGAAAAAAGAAAGAAAAAGTGTGAAGAGCCCCCTTAAGTAGTGTAGTTGAC[G/A]
TATTAAAATGATAATTTAAGATGGCTACATAACCATTTAAACAAACTAACAAGCTAAGCTACGGCGAAAAGAAATAAGTTTGTACAAAGCAATTTACCAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	43.90%	0.00%	0.00%	NA
All Indica	2759	92.60%	7.40%	0.00%	0.00%	NA
All Japonica	1512	2.50%	97.50%	0.00%	0.00%	NA
Aus	269	6.70%	93.30%	0.00%	0.00%	NA
Indica I	595	80.70%	19.30%	0.00%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	92.50%	7.50%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	3.00%	97.00%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	93.40%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015460096	C -> T	LOC_Os10g29730.1	upstream_gene_variant ; 527.0bp to feature; MODIFIER	silent_mutation	Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg1015460096	C -> T	LOC_Os10g29740.1	upstream_gene_variant ; 2710.0bp to feature; MODIFIER	silent_mutation	Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg1015460096	C -> T	LOC_Os10g29720.1	downstream_gene_variant ; 4908.0bp to feature; MODIFIER	silent_mutation	Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg1015460096	C -> T	LOC_Os10g29730-LOC_Os10g29740	intergenic_region ; MODIFIER	silent_mutation	Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015460096	NA	2.74E-19	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015460096	NA	1.79E-29	mr1551	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015460096	NA	4.46E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015460096	NA	3.32E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015460096	NA	1.17E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015460096	NA	1.48E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015460096	NA	2.13E-63	mr1970	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251