| Variant ID: vg1015460096 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15460096 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 227. )
CTGGTAAATTGCTTTGTACAAACTTATTTCTTTTCGCCGTAGCTTAGCTTGTTAGTTTGTTTAAATGGTTATGTAGCCATCTTAAATTATCATTTTAATA[C/T]
GTCAACTACACTACTTAAGGGGGCTCTTCACACTTTTTCTTTCTTTTTTCTTAAAACAAAAACTATTGCACAACTATGGCACTATCCTAACATTTGCCTA
TAGGCAAATGTTAGGATAGTGCCATAGTTGTGCAATAGTTTTTGTTTTAAGAAAAAAGAAAGAAAAAGTGTGAAGAGCCCCCTTAAGTAGTGTAGTTGAC[G/A]
TATTAAAATGATAATTTAAGATGGCTACATAACCATTTAAACAAACTAACAAGCTAAGCTACGGCGAAAAGAAATAAGTTTGTACAAAGCAATTTACCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 43.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015460096 | C -> T | LOC_Os10g29730.1 | upstream_gene_variant ; 527.0bp to feature; MODIFIER | silent_mutation | Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307 | N | N | N | N |
| vg1015460096 | C -> T | LOC_Os10g29740.1 | upstream_gene_variant ; 2710.0bp to feature; MODIFIER | silent_mutation | Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307 | N | N | N | N |
| vg1015460096 | C -> T | LOC_Os10g29720.1 | downstream_gene_variant ; 4908.0bp to feature; MODIFIER | silent_mutation | Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307 | N | N | N | N |
| vg1015460096 | C -> T | LOC_Os10g29730-LOC_Os10g29740 | intergenic_region ; MODIFIER | silent_mutation | Average:32.343; most accessible tissue: Zhenshan97 flower, score: 43.307 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015460096 | NA | 2.74E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015460096 | NA | 1.79E-29 | mr1551 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015460096 | NA | 4.46E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015460096 | NA | 3.32E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015460096 | NA | 1.17E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015460096 | NA | 1.48E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015460096 | NA | 2.13E-63 | mr1970 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |