Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015210569:

Variant ID: vg1015210569 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15210569
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGGTGTTGCTGTGCATGATCCTGAAGGCGGCGAGCCTGGCGTAGGCTCGTCGGGTGGCTCGGCGTGAGCTGCGGCAGAACCAACTCAAGTCCTGGTACA[T/C]
GGAGGTTCGAGCAAGTAACAGATTCAAGTTGGCATGGCATATTCGCCAAGGTGGAGTTTGTTAGAGTTTGTGTCGAATATGTGGACGTAGTCGGTTACAG

Reverse complement sequence

CTGTAACCGACTACGTCCACATATTCGACACAAACTCTAACAAACTCCACCTTGGCGAATATGCCATGCCAACTTGAATCTGTTACTTGCTCGAACCTCC[A/G]
TGTACCAGGACTTGAGTTGGTTCTGCCGCAGCTCACGCCGAGCCACCCGACGAGCCTACGCCAGGCTCGCCGCCTTCAGGATCATGCACAGCAACACCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	37.50%	8.00%	0.66%	NA
All Indica	2759	79.90%	9.90%	9.97%	0.29%	NA
All Japonica	1512	2.10%	94.10%	2.25%	1.52%	NA
Aus	269	87.40%	7.40%	5.20%	0.00%	NA
Indica I	595	79.80%	13.40%	6.55%	0.17%	NA
Indica II	465	84.30%	8.80%	6.88%	0.00%	NA
Indica III	913	77.30%	8.30%	14.02%	0.33%	NA
Indica Intermediate	786	80.30%	9.50%	9.67%	0.51%	NA
Temperate Japonica	767	0.70%	97.10%	2.22%	0.00%	NA
Tropical Japonica	504	2.60%	91.10%	2.58%	3.77%	NA
Japonica Intermediate	241	5.80%	90.90%	1.66%	1.66%	NA
VI/Aromatic	96	42.70%	12.50%	44.79%	0.00%	NA
Intermediate	90	38.90%	47.80%	13.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015210569	T -> C	LOC_Os10g29220.1	upstream_gene_variant ; 3110.0bp to feature; MODIFIER	silent_mutation	Average:10.67; most accessible tissue: Callus, score: 43.932	N	N	N	N
vg1015210569	T -> C	LOC_Os10g29190.1	downstream_gene_variant ; 4361.0bp to feature; MODIFIER	silent_mutation	Average:10.67; most accessible tissue: Callus, score: 43.932	N	N	N	N
vg1015210569	T -> C	LOC_Os10g29210.1	downstream_gene_variant ; 33.0bp to feature; MODIFIER	silent_mutation	Average:10.67; most accessible tissue: Callus, score: 43.932	N	N	N	N
vg1015210569	T -> C	LOC_Os10g29210-LOC_Os10g29220	intergenic_region ; MODIFIER	silent_mutation	Average:10.67; most accessible tissue: Callus, score: 43.932	N	N	N	N
vg1015210569	T -> DEL	N	N	silent_mutation	Average:10.67; most accessible tissue: Callus, score: 43.932	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015210569	NA	2.27E-06	mr1719	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015210569	NA	1.98E-22	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015210569	NA	4.99E-19	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015210569	NA	6.41E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015210569	NA	8.83E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015210569	NA	1.16E-21	mr1817_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251