Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015182572:

Variant ID: vg1015182572 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15182572
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATAAACTCTAAATACTATAAGATTCAATTTTTAAAGATTCTAAGGAGAATGAATAGAAACAGTGAGAAGGATATGACAGAAGTAAGGGGTAATAACT[G/A]
GTGTGACTTTTAAAAACTATAAAATTAGAAGCACGGGGATGATAAGGTTTGGTCTTTCAAAGTTTTAAGATAACGAGATAACTATTTAATAAATTTTAAG

Reverse complement sequence

CTTAAAATTTATTAAATAGTTATCTCGTTATCTTAAAACTTTGAAAGACCAAACCTTATCATCCCCGTGCTTCTAATTTTATAGTTTTTAAAAGTCACAC[C/T]
AGTTATTACCCCTTACTTCTGTCATATCCTTCTCACTGTTTCTATTCATTCTCCTTAGAATCTTTAAAAATTGAATCTTATAGTATTTAGAGTTTATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 13.30% 0.34% 1.78% NA
All Indica  2759 85.50% 14.30% 0.14% 0.07% NA
All Japonica  1512 98.70% 0.10% 0.13% 1.12% NA
Aus  269 17.80% 81.80% 0.37% 0.00% NA
Indica I  595 84.90% 14.50% 0.67% 0.00% NA
Indica II  465 80.60% 19.40% 0.00% 0.00% NA
Indica III  913 88.90% 11.00% 0.00% 0.11% NA
Indica Intermediate  786 84.90% 15.00% 0.00% 0.13% NA
Temperate Japonica  767 97.90% 0.00% 0.13% 1.96% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 24.00% 3.10% 7.29% 65.62% NA
Intermediate  90 85.60% 10.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015182572 G -> A LOC_Os10g29150.1 downstream_gene_variant ; 80.0bp to feature; MODIFIER silent_mutation Average:27.592; most accessible tissue: Callus, score: 55.332 N N N N
vg1015182572 G -> A LOC_Os10g29159.1 downstream_gene_variant ; 4181.0bp to feature; MODIFIER silent_mutation Average:27.592; most accessible tissue: Callus, score: 55.332 N N N N
vg1015182572 G -> A LOC_Os10g29130-LOC_Os10g29150 intergenic_region ; MODIFIER silent_mutation Average:27.592; most accessible tissue: Callus, score: 55.332 N N N N
vg1015182572 G -> DEL N N silent_mutation Average:27.592; most accessible tissue: Callus, score: 55.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015182572 NA 1.05E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 4.24E-07 1.07E-18 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 3.07E-09 5.14E-19 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 6.97E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 1.13E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 2.66E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 9.50E-09 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 1.31E-08 4.36E-56 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 2.53E-07 6.22E-31 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 1.49E-15 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 4.01E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 5.40E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 5.41E-12 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 6.51E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 7.06E-06 NA mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 1.88E-06 1.16E-21 mr1317_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 1.29E-18 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 2.40E-12 mr1608_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 2.42E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 8.28E-17 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 2.30E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 9.22E-06 3.00E-22 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 1.04E-13 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 5.08E-11 3.03E-65 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 2.22E-07 1.71E-32 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 8.89E-21 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 3.74E-12 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 8.30E-25 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 9.72E-19 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 1.28E-27 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572 NA 1.42E-16 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251