Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015181696:

Variant ID: vg1015181696 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15181696
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AAGATAAAAGTTGACAGTAGGAGTAAAAAACAGTCAATTTGTATTCGTTGCACATTATGTCACCCTAATTTCTATGGACTATGGTGATTTAAATATTCTC[A/G]
TATAAATACCAGGCATCAATAAAATTGTCAACACAATATATAACTATTAAGAAACAATACAATCAGCAACCGACAAAATAAAATCCTAATGATGATTAAA

Reverse complement sequence

TTTAATCATCATTAGGATTTTATTTTGTCGGTTGCTGATTGTATTGTTTCTTAATAGTTATATATTGTGTTGACAATTTTATTGATGCCTGGTATTTATA[T/C]
GAGAATATTTAAATCACCATAGTCCATAGAAATTAGGGTGACATAATGTGCAACGAATACAAATTGACTGTTTTTTACTCCTACTGTCAACTTTTATCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	13.80%	0.61%	1.52%	NA
All Indica	2759	84.80%	14.90%	0.22%	0.07%	NA
All Japonica	1512	98.70%	0.10%	1.06%	0.13%	NA
Aus	269	17.10%	82.20%	0.74%	0.00%	NA
Indica I	595	82.90%	16.10%	1.01%	0.00%	NA
Indica II	465	80.20%	19.80%	0.00%	0.00%	NA
Indica III	913	88.90%	11.00%	0.00%	0.11%	NA
Indica Intermediate	786	84.40%	15.50%	0.00%	0.13%	NA
Temperate Japonica	767	98.00%	0.00%	1.96%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	19.80%	7.30%	4.17%	68.75%	NA
Intermediate	90	84.40%	12.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015181696	A -> G	LOC_Os10g29130.1	upstream_gene_variant ; 4825.0bp to feature; MODIFIER	silent_mutation	Average:41.636; most accessible tissue: Callus, score: 73.421	N	N	N	N
vg1015181696	A -> G	LOC_Os10g29150.1	downstream_gene_variant ; 956.0bp to feature; MODIFIER	silent_mutation	Average:41.636; most accessible tissue: Callus, score: 73.421	N	N	N	N
vg1015181696	A -> G	LOC_Os10g29130-LOC_Os10g29150	intergenic_region ; MODIFIER	silent_mutation	Average:41.636; most accessible tissue: Callus, score: 73.421	N	N	N	N
vg1015181696	A -> DEL	N	N	silent_mutation	Average:41.636; most accessible tissue: Callus, score: 73.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015181696	3.98E-07	1.17E-14	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	1.46E-08	3.60E-18	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	2.57E-10	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	8.42E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	4.07E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	8.03E-09	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	1.00E-08	7.20E-50	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	1.87E-06	4.44E-29	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	2.86E-12	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	6.64E-06	mr1897	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	4.85E-06	2.72E-17	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	1.35E-17	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	1.91E-10	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	6.99E-09	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	4.39E-13	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	9.01E-10	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	8.59E-06	mr1649_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	1.92E-18	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	2.25E-13	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	1.69E-09	6.57E-58	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	5.60E-07	5.22E-31	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	1.34E-17	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	1.66E-11	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	1.98E-06	1.21E-25	mr1914_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	1.51E-18	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	4.73E-23	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696	NA	8.01E-16	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251