\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015181696:

Variant ID: vg1015181696 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15181696
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATAAAAGTTGACAGTAGGAGTAAAAAACAGTCAATTTGTATTCGTTGCACATTATGTCACCCTAATTTCTATGGACTATGGTGATTTAAATATTCTC[A/G]
TATAAATACCAGGCATCAATAAAATTGTCAACACAATATATAACTATTAAGAAACAATACAATCAGCAACCGACAAAATAAAATCCTAATGATGATTAAA

Reverse complement sequence

TTTAATCATCATTAGGATTTTATTTTGTCGGTTGCTGATTGTATTGTTTCTTAATAGTTATATATTGTGTTGACAATTTTATTGATGCCTGGTATTTATA[T/C]
GAGAATATTTAAATCACCATAGTCCATAGAAATTAGGGTGACATAATGTGCAACGAATACAAATTGACTGTTTTTTACTCCTACTGTCAACTTTTATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 13.80% 0.61% 1.52% NA
All Indica  2759 84.80% 14.90% 0.22% 0.07% NA
All Japonica  1512 98.70% 0.10% 1.06% 0.13% NA
Aus  269 17.10% 82.20% 0.74% 0.00% NA
Indica I  595 82.90% 16.10% 1.01% 0.00% NA
Indica II  465 80.20% 19.80% 0.00% 0.00% NA
Indica III  913 88.90% 11.00% 0.00% 0.11% NA
Indica Intermediate  786 84.40% 15.50% 0.00% 0.13% NA
Temperate Japonica  767 98.00% 0.00% 1.96% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 19.80% 7.30% 4.17% 68.75% NA
Intermediate  90 84.40% 12.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015181696 A -> G LOC_Os10g29130.1 upstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:41.636; most accessible tissue: Callus, score: 73.421 N N N N
vg1015181696 A -> G LOC_Os10g29150.1 downstream_gene_variant ; 956.0bp to feature; MODIFIER silent_mutation Average:41.636; most accessible tissue: Callus, score: 73.421 N N N N
vg1015181696 A -> G LOC_Os10g29130-LOC_Os10g29150 intergenic_region ; MODIFIER silent_mutation Average:41.636; most accessible tissue: Callus, score: 73.421 N N N N
vg1015181696 A -> DEL N N silent_mutation Average:41.636; most accessible tissue: Callus, score: 73.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015181696 3.98E-07 1.17E-14 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 1.46E-08 3.60E-18 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 2.57E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 8.42E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 4.07E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 8.03E-09 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 1.00E-08 7.20E-50 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 1.87E-06 4.44E-29 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 2.86E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 6.64E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 4.85E-06 2.72E-17 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 1.35E-17 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 1.91E-10 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 6.99E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 4.39E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 9.01E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 8.59E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 1.92E-18 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 2.25E-13 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 1.69E-09 6.57E-58 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 5.60E-07 5.22E-31 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 1.34E-17 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 1.66E-11 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 1.98E-06 1.21E-25 mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 1.51E-18 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 4.73E-23 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015181696 NA 8.01E-16 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251