Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1015010798:

Variant ID: vg1015010798 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15010798
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAGGTCCTTGACAAGAGATGGGCAGCTCTGCATCAGATGCAGGAAGCCGTCGGTCGCCATCACCGCGTTCAGCGTCTCCTTCGACTCGAGGAACCGGAA[G/A]
CACGCCTCCTTGAGGGCTTGGCAATGGTGCTGCTCTGCCAACGCCATGAGCGTCGCCACCGAGCCCCGGTCGATGTACTCGACCACCTTCTCCTCGCAGA

Reverse complement sequence

TCTGCGAGGAGAAGGTGGTCGAGTACATCGACCGGGGCTCGGTGGCGACGCTCATGGCGTTGGCAGAGCAGCACCATTGCCAAGCCCTCAAGGAGGCGTG[C/T]
TTCCGGTTCCTCGAGTCGAAGGAGACGCTGAACGCGGTGATGGCGACCGACGGCTTCCTGCATCTGATGCAGAGCTGCCCATCTCTTGTCAAGGACCTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	37.20%	4.66%	1.99%	NA
All Indica	2759	84.80%	4.00%	7.83%	3.37%	NA
All Japonica	1512	0.70%	99.20%	0.13%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	87.60%	5.00%	4.87%	2.52%	NA
Indica II	465	69.90%	6.50%	15.70%	7.96%	NA
Indica III	913	93.30%	1.00%	4.82%	0.88%	NA
Indica Intermediate	786	81.70%	5.20%	8.91%	4.20%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	40.00%	57.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015010798	G -> A	LOC_Os10g28780.1	synonymous_variant ; p.Cys340Cys; LOW	synonymous_codon	Average:84.424; most accessible tissue: Zhenshan97 flower, score: 93.007	N	N	N	N
vg1015010798	G -> DEL	LOC_Os10g28780.1	N	frameshift_variant	Average:84.424; most accessible tissue: Zhenshan97 flower, score: 93.007	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1015010798	G	A	0.02	0.01	0.01	0.01	0.03	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015010798	NA	1.85E-70	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.57E-73	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	8.36E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	3.70E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	3.51E-43	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.11E-59	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	2.12E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	4.96E-41	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.52E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	3.62E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.85E-89	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	3.44E-06	9.79E-07	mr1758	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	5.48E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.19E-42	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.36E-98	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015010798	NA	1.99E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251