\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014950297:

Variant ID: vg1014950297 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14950297
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAAACTTGACACCCCTGAATATAAACACCCCCTTAGCAAGAAAAATATGTTCATGGAAAGTTTCACAATGACCATATTGACCACAAGAAAAAAAGGG[A/G]
TTACACTCAGCTTGAGTTTGTTAGGAATCAGGAGTTCATAAATAAAGATGAAAGAGCACAAAACACTGGTCTATCTTGAAATTCTTGTGAGAAATAGACA

Reverse complement sequence

TGTCTATTTCTCACAAGAATTTCAAGATAGACCAGTGTTTTGTGCTCTTTCATCTTTATTTATGAACTCCTGATTCCTAACAAACTCAAGCTGAGTGTAA[T/C]
CCCTTTTTTTCTTGTGGTCAATATGGTCATTGTGAAACTTTCCATGAACATATTTTTCTTGCTAAGGGGGTGTTTATATTCAGGGGTGTCAAGTTTTGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 28.70% 0.04% 0.00% NA
All Indica  2759 57.90% 42.00% 0.07% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 83.00% 16.80% 0.17% 0.00% NA
Indica II  465 40.20% 59.80% 0.00% 0.00% NA
Indica III  913 53.60% 46.40% 0.00% 0.00% NA
Indica Intermediate  786 54.30% 45.50% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014950297 A -> G LOC_Os10g28660.1 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:50.047; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1014950297 A -> G LOC_Os10g28665.2 downstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:50.047; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1014950297 A -> G LOC_Os10g28660-LOC_Os10g28665 intergenic_region ; MODIFIER silent_mutation Average:50.047; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014950297 NA 7.57E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297 NA 1.03E-10 mr1169_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297 NA 2.50E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297 NA 1.99E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297 NA 2.68E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297 NA 4.73E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297 NA 1.04E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251