\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014788162:

Variant ID: vg1014788162 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14788162
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCATCCCGCACACGGGGAATAAATCCTCGAGGGGTCTTCGTCCGCACTTAAAACAATATGCATATGTCAAATTATATATACAATTAAACATATATTC[T/C]
CACTTTATATTAATAAATAAATATATATATCTAGTAATATTATCTACTAATTCACATGATAAAAACACAATATTATCGTTTATCAAAGATTACCAGTAAT

Reverse complement sequence

ATTACTGGTAATCTTTGATAAACGATAATATTGTGTTTTTATCATGTGAATTAGTAGATAATATTACTAGATATATATATTTATTTATTAATATAAAGTG[A/G]
GAATATATGTTTAATTGTATATATAATTTGACATATGCATATTGTTTTAAGTGCGGACGAAGACCCCTCGAGGATTTATTCCCCGTGTGCGGGATGGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 34.30% 6.94% 2.81% NA
All Indica  2759 87.30% 1.80% 7.29% 3.66% NA
All Japonica  1512 1.70% 95.00% 2.65% 0.66% NA
Aus  269 60.60% 2.20% 29.00% 8.18% NA
Indica I  595 79.20% 0.80% 12.61% 7.39% NA
Indica II  465 90.30% 3.00% 3.23% 3.44% NA
Indica III  913 91.70% 0.70% 5.81% 1.86% NA
Indica Intermediate  786 86.50% 3.10% 7.38% 3.05% NA
Temperate Japonica  767 1.30% 93.60% 3.78% 1.30% NA
Tropical Japonica  504 1.20% 97.60% 1.19% 0.00% NA
Japonica Intermediate  241 3.70% 94.20% 2.07% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 38.90% 52.20% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014788162 T -> C LOC_Os10g28420.1 downstream_gene_variant ; 1504.0bp to feature; MODIFIER silent_mutation Average:55.897; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg1014788162 T -> C LOC_Os10g28430.1 downstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:55.897; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg1014788162 T -> C LOC_Os10g28420-LOC_Os10g28430 intergenic_region ; MODIFIER silent_mutation Average:55.897; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg1014788162 T -> DEL N N silent_mutation Average:55.897; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014788162 NA 1.35E-68 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.01E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.34E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.83E-31 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 2.21E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 5.85E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.82E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 3.10E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 3.25E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 1.69E-06 7.23E-64 mr1594 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 8.93E-44 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 4.39E-36 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 3.42E-38 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.77E-38 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 4.20E-28 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 3.19E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 8.53E-22 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.14E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 7.98E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 5.65E-17 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 4.06E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 9.73E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.17E-46 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 5.25E-06 5.25E-06 mr1542_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 3.71E-07 1.02E-52 mr1591_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 2.35E-09 1.17E-78 mr1594_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 6.88E-06 3.54E-07 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 2.97E-22 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 4.44E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 4.33E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 2.65E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 1.50E-89 mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 6.04E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 2.60E-06 1.52E-54 mr1890_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 NA 7.05E-35 mr1891_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014788162 2.81E-06 2.81E-06 mr1973_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251