\
| Variant ID: vg1014775956 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14775956 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCGATCAGGGAAAGATGGGATGCGTGTAGGTGTTATTATGTACTACCCCGTTTCAGATTACAGTTATTTTTGATTTTGGTCAAAGTCTCACTGCTTCAA[G/A]
TTGAACCAAATTTATAAAAAAATATAGTAATATATTTAACATAAGACAGATATATTATAAAAATATATTAAATCTATAATTTAATAAAACTAATTTGGTG
CACCAAATTAGTTTTATTAAATTATAGATTTAATATATTTTTATAATATATCTGTCTTATGTTAAATATATTACTATATTTTTTTATAAATTTGGTTCAA[C/T]
TTGAAGCAGTGAGACTTTGACCAAAATCAAAAATAACTGTAATCTGAAACGGGGTAGTACATAATAACACCTACACGCATCCCATCTTTCCCTGATCGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 10.60% | 1.48% | 25.58% | NA |
| All Indica | 2759 | 41.60% | 17.50% | 1.45% | 39.47% | NA |
| All Japonica | 1512 | 98.70% | 0.30% | 0.00% | 0.99% | NA |
| Aus | 269 | 53.20% | 0.70% | 10.41% | 35.69% | NA |
| Indica I | 595 | 42.50% | 4.00% | 2.02% | 51.43% | NA |
| Indica II | 465 | 42.80% | 40.40% | 0.65% | 16.13% | NA |
| Indica III | 913 | 38.70% | 13.60% | 1.10% | 46.66% | NA |
| Indica Intermediate | 786 | 43.60% | 18.60% | 1.91% | 35.88% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.40% | 0.20% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 72.20% | 16.70% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014775956 | G -> A | LOC_Os10g28400.1 | upstream_gene_variant ; 115.0bp to feature; MODIFIER | silent_mutation | Average:66.068; most accessible tissue: Callus, score: 83.011 | N | N | N | N |
| vg1014775956 | G -> A | LOC_Os10g28390.1 | downstream_gene_variant ; 2775.0bp to feature; MODIFIER | silent_mutation | Average:66.068; most accessible tissue: Callus, score: 83.011 | N | N | N | N |
| vg1014775956 | G -> A | LOC_Os10g28410.1 | downstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:66.068; most accessible tissue: Callus, score: 83.011 | N | N | N | N |
| vg1014775956 | G -> A | LOC_Os10g28410.2 | downstream_gene_variant ; 495.0bp to feature; MODIFIER | silent_mutation | Average:66.068; most accessible tissue: Callus, score: 83.011 | N | N | N | N |
| vg1014775956 | G -> A | LOC_Os10g28400-LOC_Os10g28410 | intergenic_region ; MODIFIER | silent_mutation | Average:66.068; most accessible tissue: Callus, score: 83.011 | N | N | N | N |
| vg1014775956 | G -> DEL | N | N | silent_mutation | Average:66.068; most accessible tissue: Callus, score: 83.011 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014775956 | NA | 1.97E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014775956 | NA | 4.53E-07 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014775956 | NA | 5.14E-15 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014775956 | NA | 4.11E-13 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014775956 | NA | 2.18E-12 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014775956 | NA | 1.96E-12 | mr1347_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014775956 | NA | 3.11E-07 | mr1406_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |