Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014775956:

Variant ID: vg1014775956 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14775956
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGATCAGGGAAAGATGGGATGCGTGTAGGTGTTATTATGTACTACCCCGTTTCAGATTACAGTTATTTTTGATTTTGGTCAAAGTCTCACTGCTTCAA[G/A]
TTGAACCAAATTTATAAAAAAATATAGTAATATATTTAACATAAGACAGATATATTATAAAAATATATTAAATCTATAATTTAATAAAACTAATTTGGTG

Reverse complement sequence

CACCAAATTAGTTTTATTAAATTATAGATTTAATATATTTTTATAATATATCTGTCTTATGTTAAATATATTACTATATTTTTTTATAAATTTGGTTCAA[C/T]
TTGAAGCAGTGAGACTTTGACCAAAATCAAAAATAACTGTAATCTGAAACGGGGTAGTACATAATAACACCTACACGCATCCCATCTTTCCCTGATCGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	10.60%	1.48%	25.58%	NA
All Indica	2759	41.60%	17.50%	1.45%	39.47%	NA
All Japonica	1512	98.70%	0.30%	0.00%	0.99%	NA
Aus	269	53.20%	0.70%	10.41%	35.69%	NA
Indica I	595	42.50%	4.00%	2.02%	51.43%	NA
Indica II	465	42.80%	40.40%	0.65%	16.13%	NA
Indica III	913	38.70%	13.60%	1.10%	46.66%	NA
Indica Intermediate	786	43.60%	18.60%	1.91%	35.88%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	98.40%	0.20%	0.00%	1.39%	NA
Japonica Intermediate	241	95.90%	1.20%	0.00%	2.90%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	72.20%	16.70%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014775956	G -> A	LOC_Os10g28400.1	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:66.068; most accessible tissue: Callus, score: 83.011	N	N	N	N
vg1014775956	G -> A	LOC_Os10g28390.1	downstream_gene_variant ; 2775.0bp to feature; MODIFIER	silent_mutation	Average:66.068; most accessible tissue: Callus, score: 83.011	N	N	N	N
vg1014775956	G -> A	LOC_Os10g28410.1	downstream_gene_variant ; 465.0bp to feature; MODIFIER	silent_mutation	Average:66.068; most accessible tissue: Callus, score: 83.011	N	N	N	N
vg1014775956	G -> A	LOC_Os10g28410.2	downstream_gene_variant ; 495.0bp to feature; MODIFIER	silent_mutation	Average:66.068; most accessible tissue: Callus, score: 83.011	N	N	N	N
vg1014775956	G -> A	LOC_Os10g28400-LOC_Os10g28410	intergenic_region ; MODIFIER	silent_mutation	Average:66.068; most accessible tissue: Callus, score: 83.011	N	N	N	N
vg1014775956	G -> DEL	N	N	silent_mutation	Average:66.068; most accessible tissue: Callus, score: 83.011	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014775956	NA	1.97E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956	NA	4.53E-07	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956	NA	5.14E-15	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956	NA	4.11E-13	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956	NA	2.18E-12	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956	NA	1.96E-12	mr1347_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956	NA	3.11E-07	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251