\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014775956:

Variant ID: vg1014775956 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14775956
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGATCAGGGAAAGATGGGATGCGTGTAGGTGTTATTATGTACTACCCCGTTTCAGATTACAGTTATTTTTGATTTTGGTCAAAGTCTCACTGCTTCAA[G/A]
TTGAACCAAATTTATAAAAAAATATAGTAATATATTTAACATAAGACAGATATATTATAAAAATATATTAAATCTATAATTTAATAAAACTAATTTGGTG

Reverse complement sequence

CACCAAATTAGTTTTATTAAATTATAGATTTAATATATTTTTATAATATATCTGTCTTATGTTAAATATATTACTATATTTTTTTATAAATTTGGTTCAA[C/T]
TTGAAGCAGTGAGACTTTGACCAAAATCAAAAATAACTGTAATCTGAAACGGGGTAGTACATAATAACACCTACACGCATCCCATCTTTCCCTGATCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 10.60% 1.48% 25.58% NA
All Indica  2759 41.60% 17.50% 1.45% 39.47% NA
All Japonica  1512 98.70% 0.30% 0.00% 0.99% NA
Aus  269 53.20% 0.70% 10.41% 35.69% NA
Indica I  595 42.50% 4.00% 2.02% 51.43% NA
Indica II  465 42.80% 40.40% 0.65% 16.13% NA
Indica III  913 38.70% 13.60% 1.10% 46.66% NA
Indica Intermediate  786 43.60% 18.60% 1.91% 35.88% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 98.40% 0.20% 0.00% 1.39% NA
Japonica Intermediate  241 95.90% 1.20% 0.00% 2.90% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 72.20% 16.70% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014775956 G -> A LOC_Os10g28400.1 upstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:66.068; most accessible tissue: Callus, score: 83.011 N N N N
vg1014775956 G -> A LOC_Os10g28390.1 downstream_gene_variant ; 2775.0bp to feature; MODIFIER silent_mutation Average:66.068; most accessible tissue: Callus, score: 83.011 N N N N
vg1014775956 G -> A LOC_Os10g28410.1 downstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:66.068; most accessible tissue: Callus, score: 83.011 N N N N
vg1014775956 G -> A LOC_Os10g28410.2 downstream_gene_variant ; 495.0bp to feature; MODIFIER silent_mutation Average:66.068; most accessible tissue: Callus, score: 83.011 N N N N
vg1014775956 G -> A LOC_Os10g28400-LOC_Os10g28410 intergenic_region ; MODIFIER silent_mutation Average:66.068; most accessible tissue: Callus, score: 83.011 N N N N
vg1014775956 G -> DEL N N silent_mutation Average:66.068; most accessible tissue: Callus, score: 83.011 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014775956 NA 1.97E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956 NA 4.53E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956 NA 5.14E-15 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956 NA 4.11E-13 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956 NA 2.18E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956 NA 1.96E-12 mr1347_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014775956 NA 3.11E-07 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251