\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014721016:

Variant ID: vg1014721016 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14721016
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


GTACCTTGAGAGACTGGACTGATATCTTATTGTTGATTAGTATATATGTCATTTATCACTGAAATAATAATTAACTATAAATATAAATATTCATGTTAAG[T/C]
TTAGGATTTAATCCCGGACAGAAAAGATTCATCACAAGTAACTTAGTCAGTAACATTTTGACGGCACAGCAGAATTAAAATGGAGTACTTGGCCAACTTG

Reverse complement sequence

CAAGTTGGCCAAGTACTCCATTTTAATTCTGCTGTGCCGTCAAAATGTTACTGACTAAGTTACTTGTGATGAATCTTTTCTGTCCGGGATTAAATCCTAA[A/G]
CTTAACATGAATATTTATATTTATAGTTAATTATTATTTCAGTGATAAATGACATATATACTAATCAACAATAAGATATCAGTCCAGTCTCTCAAGGTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 8.20% 0.83% 0.00% NA
All Indica  2759 84.80% 13.80% 1.41% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.10% 0.70% 2.18% 0.00% NA
Indica II  465 83.00% 15.70% 1.29% 0.00% NA
Indica III  913 77.30% 22.50% 0.22% 0.00% NA
Indica Intermediate  786 85.10% 12.60% 2.29% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014721016 T -> C LOC_Os10g28299.1 upstream_gene_variant ; 2686.0bp to feature; MODIFIER silent_mutation Average:52.679; most accessible tissue: Callus, score: 77.014 N N N N
vg1014721016 T -> C LOC_Os10g28310.1 upstream_gene_variant ; 4809.0bp to feature; MODIFIER silent_mutation Average:52.679; most accessible tissue: Callus, score: 77.014 N N N N
vg1014721016 T -> C LOC_Os10g28299-LOC_Os10g28310 intergenic_region ; MODIFIER silent_mutation Average:52.679; most accessible tissue: Callus, score: 77.014 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014721016 NA 4.40E-08 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 3.06E-09 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 5.96E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 8.68E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 4.34E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 5.17E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 2.33E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016 NA 6.88E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251