\
| Variant ID: vg1014721016 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14721016 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 127. )
GTACCTTGAGAGACTGGACTGATATCTTATTGTTGATTAGTATATATGTCATTTATCACTGAAATAATAATTAACTATAAATATAAATATTCATGTTAAG[T/C]
TTAGGATTTAATCCCGGACAGAAAAGATTCATCACAAGTAACTTAGTCAGTAACATTTTGACGGCACAGCAGAATTAAAATGGAGTACTTGGCCAACTTG
CAAGTTGGCCAAGTACTCCATTTTAATTCTGCTGTGCCGTCAAAATGTTACTGACTAAGTTACTTGTGATGAATCTTTTCTGTCCGGGATTAAATCCTAA[A/G]
CTTAACATGAATATTTATATTTATAGTTAATTATTATTTCAGTGATAAATGACATATATACTAATCAACAATAAGATATCAGTCCAGTCTCTCAAGGTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 8.20% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 84.80% | 13.80% | 1.41% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 0.70% | 2.18% | 0.00% | NA |
| Indica II | 465 | 83.00% | 15.70% | 1.29% | 0.00% | NA |
| Indica III | 913 | 77.30% | 22.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 12.60% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014721016 | T -> C | LOC_Os10g28299.1 | upstream_gene_variant ; 2686.0bp to feature; MODIFIER | silent_mutation | Average:52.679; most accessible tissue: Callus, score: 77.014 | N | N | N | N |
| vg1014721016 | T -> C | LOC_Os10g28310.1 | upstream_gene_variant ; 4809.0bp to feature; MODIFIER | silent_mutation | Average:52.679; most accessible tissue: Callus, score: 77.014 | N | N | N | N |
| vg1014721016 | T -> C | LOC_Os10g28299-LOC_Os10g28310 | intergenic_region ; MODIFIER | silent_mutation | Average:52.679; most accessible tissue: Callus, score: 77.014 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014721016 | NA | 4.40E-08 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 3.06E-09 | mr1080 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 5.96E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 8.68E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 4.34E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 5.17E-07 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 2.33E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014721016 | NA | 6.88E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |