Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014721016:

Variant ID: vg1014721016 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14721016
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

GTACCTTGAGAGACTGGACTGATATCTTATTGTTGATTAGTATATATGTCATTTATCACTGAAATAATAATTAACTATAAATATAAATATTCATGTTAAG[T/C]
TTAGGATTTAATCCCGGACAGAAAAGATTCATCACAAGTAACTTAGTCAGTAACATTTTGACGGCACAGCAGAATTAAAATGGAGTACTTGGCCAACTTG

Reverse complement sequence

CAAGTTGGCCAAGTACTCCATTTTAATTCTGCTGTGCCGTCAAAATGTTACTGACTAAGTTACTTGTGATGAATCTTTTCTGTCCGGGATTAAATCCTAA[A/G]
CTTAACATGAATATTTATATTTATAGTTAATTATTATTTCAGTGATAAATGACATATATACTAATCAACAATAAGATATCAGTCCAGTCTCTCAAGGTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	8.20%	0.83%	0.00%	NA
All Indica	2759	84.80%	13.80%	1.41%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.10%	0.70%	2.18%	0.00%	NA
Indica II	465	83.00%	15.70%	1.29%	0.00%	NA
Indica III	913	77.30%	22.50%	0.22%	0.00%	NA
Indica Intermediate	786	85.10%	12.60%	2.29%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014721016	T -> C	LOC_Os10g28299.1	upstream_gene_variant ; 2686.0bp to feature; MODIFIER	silent_mutation	Average:52.679; most accessible tissue: Callus, score: 77.014	N	N	N	N
vg1014721016	T -> C	LOC_Os10g28310.1	upstream_gene_variant ; 4809.0bp to feature; MODIFIER	silent_mutation	Average:52.679; most accessible tissue: Callus, score: 77.014	N	N	N	N
vg1014721016	T -> C	LOC_Os10g28299-LOC_Os10g28310	intergenic_region ; MODIFIER	silent_mutation	Average:52.679; most accessible tissue: Callus, score: 77.014	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014721016	NA	4.40E-08	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	3.06E-09	mr1080	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	5.96E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	8.68E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	4.34E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	5.17E-07	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	2.33E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014721016	NA	6.88E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251