\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014630581:

Variant ID: vg1014630581 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14630581
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGACGATGTTCTTAGTGAGAGCACACATGAACAAGTGGAAAATCATGGTGATGGTGATAATGTTGATGACAGTAGTGTCCATATCGATTTGGACAGTT[C/T]
AGACACTGCTTTTCAGCCTGAAATTTTTGATCCAAGGTGTTGGGATTCTCTTGATGCTAAACAACTTGACATTCTTGCTCAATTAGGTCCTAAAAGGGAC

Reverse complement sequence

GTCCCTTTTAGGACCTAATTGAGCAAGAATGTCAAGTTGTTTAGCATCAAGAGAATCCCAACACCTTGGATCAAAAATTTCAGGCTGAAAAGCAGTGTCT[G/A]
AACTGTCCAAATCGATATGGACACTACTGTCATCAACATTATCACCATCACCATGATTTTCCACTTGTTCATGTGTGCTCTCACTAAGAACATCGTCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 11.00% 0.95% 0.08% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 64.70% 32.30% 2.78% 0.26% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 94.40% 4.40% 1.17% 0.00% NA
Tropical Japonica  504 17.50% 76.20% 5.56% 0.79% NA
Japonica Intermediate  241 68.90% 29.00% 2.07% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014630581 C -> T LOC_Os10g28180.1 missense_variant ; p.Ser94Leu; MODERATE nonsynonymous_codon ; S94L Average:58.985; most accessible tissue: Zhenshan97 young leaf, score: 87.859 unknown unknown TOLERATED 0.24
vg1014630581 C -> DEL LOC_Os10g28180.1 N frameshift_variant Average:58.985; most accessible tissue: Zhenshan97 young leaf, score: 87.859 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1014630581 C T -0.09 -0.16 -0.1 -0.05 -0.14 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014630581 NA 3.27E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 1.87E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 5.10E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 1.51E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 1.54E-06 NA mr1591 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 6.94E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 2.53E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 7.73E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 2.49E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 1.29E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 6.80E-11 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 2.89E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014630581 NA 3.04E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251