Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014532349:

Variant ID: vg1014532349 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14532349
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAATCTAAACAAGTTACTAGGTTACTATATTATGGACGGAGAGAGTATATGTGATTTTCCTAATAGTGTATTTCCTCCGTCCATTAAAAAAACAAACC[T/C]
AGCACATATTAAGACACATCCTCTCCATCTCATAGTACTGTAATATAGCAATTTAGTACCGGTTGAAATATATCATAATAGTATGATGAATCTAAATAAG

Reverse complement sequence

CTTATTTAGATTCATCATACTATTATGATATATTTCAACCGGTACTAAATTGCTATATTACAGTACTATGAGATGGAGAGGATGTGTCTTAATATGTGCT[A/G]
GGTTTGTTTTTTTAATGGACGGAGGAAATACACTATTAGGAAAATCACATATACTCTCTCCGTCCATAATATAGTAACCTAGTAACTTGTTTAGATTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.90%	41.60%	4.76%	1.76%	NA
All Indica	2759	78.30%	13.80%	5.51%	2.43%	NA
All Japonica	1512	0.90%	99.00%	0.07%	0.07%	NA
Aus	269	73.20%	0.40%	22.68%	3.72%	NA
Indica I	595	83.20%	0.80%	12.61%	3.36%	NA
Indica II	465	70.80%	22.40%	5.38%	1.51%	NA
Indica III	913	80.60%	16.00%	1.75%	1.64%	NA
Indica Intermediate	786	76.30%	15.90%	4.58%	3.18%	NA
Temperate Japonica	767	0.00%	100.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.40%	0.20%	0.20%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	43.80%	41.70%	10.42%	4.17%	NA
Intermediate	90	44.40%	53.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014532349	T -> C	LOC_Os10g28020.1	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1014532349	T -> C	LOC_Os10g28020.2	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1014532349	T -> C	LOC_Os10g28020.3	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1014532349	T -> C	LOC_Os10g28020.4	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1014532349	T -> C	LOC_Os10g28009-LOC_Os10g28020	intergenic_region ; MODIFIER	silent_mutation	Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1014532349	T -> DEL	N	N	silent_mutation	Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014532349	NA	6.13E-19	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	6.06E-19	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	3.06E-20	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	4.34E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	7.99E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	4.67E-17	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	2.22E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	7.71E-15	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	7.78E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	3.02E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	4.79E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.13E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	4.38E-19	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	6.44E-14	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	3.43E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	2.21E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.14E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.20E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	3.04E-19	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.85E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.59E-29	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	6.48E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	3.44E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	7.14E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	8.41E-16	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	5.45E-06	mr1765	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.78E-19	mr1950	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.39E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	5.62E-18	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	9.46E-20	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	2.02E-21	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	4.80E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.32E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	4.39E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	7.30E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	6.16E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349	NA	1.97E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251