\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014532349:

Variant ID: vg1014532349 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14532349
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAATCTAAACAAGTTACTAGGTTACTATATTATGGACGGAGAGAGTATATGTGATTTTCCTAATAGTGTATTTCCTCCGTCCATTAAAAAAACAAACC[T/C]
AGCACATATTAAGACACATCCTCTCCATCTCATAGTACTGTAATATAGCAATTTAGTACCGGTTGAAATATATCATAATAGTATGATGAATCTAAATAAG

Reverse complement sequence

CTTATTTAGATTCATCATACTATTATGATATATTTCAACCGGTACTAAATTGCTATATTACAGTACTATGAGATGGAGAGGATGTGTCTTAATATGTGCT[A/G]
GGTTTGTTTTTTTAATGGACGGAGGAAATACACTATTAGGAAAATCACATATACTCTCTCCGTCCATAATATAGTAACCTAGTAACTTGTTTAGATTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 41.60% 4.76% 1.76% NA
All Indica  2759 78.30% 13.80% 5.51% 2.43% NA
All Japonica  1512 0.90% 99.00% 0.07% 0.07% NA
Aus  269 73.20% 0.40% 22.68% 3.72% NA
Indica I  595 83.20% 0.80% 12.61% 3.36% NA
Indica II  465 70.80% 22.40% 5.38% 1.51% NA
Indica III  913 80.60% 16.00% 1.75% 1.64% NA
Indica Intermediate  786 76.30% 15.90% 4.58% 3.18% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.40% 0.20% 0.20% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 41.70% 10.42% 4.17% NA
Intermediate  90 44.40% 53.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014532349 T -> C LOC_Os10g28020.1 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1014532349 T -> C LOC_Os10g28020.2 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1014532349 T -> C LOC_Os10g28020.3 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1014532349 T -> C LOC_Os10g28020.4 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1014532349 T -> C LOC_Os10g28009-LOC_Os10g28020 intergenic_region ; MODIFIER silent_mutation Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1014532349 T -> DEL N N silent_mutation Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014532349 NA 6.13E-19 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 6.06E-19 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 3.06E-20 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 4.34E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 7.99E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 4.67E-17 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 2.22E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 7.71E-15 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 7.78E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 3.02E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 4.79E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.13E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 4.38E-19 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 6.44E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 3.43E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 2.21E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.14E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.20E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 3.04E-19 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.85E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.59E-29 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 6.48E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 3.44E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 7.14E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 8.41E-16 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 5.45E-06 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.78E-19 mr1950 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.39E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 5.62E-18 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 9.46E-20 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 2.02E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 4.80E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.32E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 4.39E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 7.30E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 6.16E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014532349 NA 1.97E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251