\
| Variant ID: vg1014532349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14532349 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 177. )
ATGAATCTAAACAAGTTACTAGGTTACTATATTATGGACGGAGAGAGTATATGTGATTTTCCTAATAGTGTATTTCCTCCGTCCATTAAAAAAACAAACC[T/C]
AGCACATATTAAGACACATCCTCTCCATCTCATAGTACTGTAATATAGCAATTTAGTACCGGTTGAAATATATCATAATAGTATGATGAATCTAAATAAG
CTTATTTAGATTCATCATACTATTATGATATATTTCAACCGGTACTAAATTGCTATATTACAGTACTATGAGATGGAGAGGATGTGTCTTAATATGTGCT[A/G]
GGTTTGTTTTTTTAATGGACGGAGGAAATACACTATTAGGAAAATCACATATACTCTCTCCGTCCATAATATAGTAACCTAGTAACTTGTTTAGATTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 41.60% | 4.76% | 1.76% | NA |
| All Indica | 2759 | 78.30% | 13.80% | 5.51% | 2.43% | NA |
| All Japonica | 1512 | 0.90% | 99.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 73.20% | 0.40% | 22.68% | 3.72% | NA |
| Indica I | 595 | 83.20% | 0.80% | 12.61% | 3.36% | NA |
| Indica II | 465 | 70.80% | 22.40% | 5.38% | 1.51% | NA |
| Indica III | 913 | 80.60% | 16.00% | 1.75% | 1.64% | NA |
| Indica Intermediate | 786 | 76.30% | 15.90% | 4.58% | 3.18% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.40% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 41.70% | 10.42% | 4.17% | NA |
| Intermediate | 90 | 44.40% | 53.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014532349 | T -> C | LOC_Os10g28020.1 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1014532349 | T -> C | LOC_Os10g28020.2 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1014532349 | T -> C | LOC_Os10g28020.3 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1014532349 | T -> C | LOC_Os10g28020.4 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1014532349 | T -> C | LOC_Os10g28009-LOC_Os10g28020 | intergenic_region ; MODIFIER | silent_mutation | Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1014532349 | T -> DEL | N | N | silent_mutation | Average:36.243; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014532349 | NA | 6.13E-19 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 6.06E-19 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 3.06E-20 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 4.34E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 7.99E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 4.67E-17 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 2.22E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 7.71E-15 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 7.78E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 3.02E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 4.79E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.13E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 4.38E-19 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 6.44E-14 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 3.43E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 2.21E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.14E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.20E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 3.04E-19 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.85E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.59E-29 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 6.48E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 3.44E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 7.14E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 8.41E-16 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 5.45E-06 | mr1765 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.78E-19 | mr1950 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.39E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 5.62E-18 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 9.46E-20 | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 2.02E-21 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 4.80E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.32E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 4.39E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 7.30E-16 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 6.16E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014532349 | NA | 1.97E-15 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |