\
| Variant ID: vg1014284779 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 14284779 |
| Reference Allele: G | Alternative Allele: GGATTTGGAGTTAT,C,GGACTTGGAGTTGT |
| Primary Allele: GGATTTGGAGTTAT | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTAGTCCACGATATGTAGTCCAATTTGCCATTCACTCTTATTTTTTATTTTAATTGTTAGAGTTTATGTCGAATATGTGTATATAGTCGGTTACAGTTTA[G/GGATTTGGAGTTAT,C,GGACTTGGAGTTGT]
AAATTGGAATAGAGTAAGAGTCGGACTCTATCCTTGGATCTCTCTTAAATAGAGAGGTGGACCTGTTGTAACTGCATGGTGACTTAGCATAGCGAGAGGG
CCCTCTCGCTATGCTAAGTCACCATGCAGTTACAACAGGTCCACCTCTCTATTTAAGAGAGATCCAAGGATAGAGTCCGACTCTTACTCTATTCCAATTT[C/ATAACTCCAAATCC,G,ACAACTCCAAGTCC]
TAAACTGTAACCGACTATATACACATATTCGACATAAACTCTAACAATTAAAATAAAAAATAAGAGTGAATGGCAAATTGGACTACATATCGTGGACTAA
| Populations | Population Size | Frequency of GGATTTGGAGTTAT(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 23.60% | 3.72% | 0.00% | G: 21.94%; GGACTTGGAGTTGT: 0.02% |
| All Indica | 2759 | 79.40% | 0.70% | 5.26% | 0.00% | G: 14.72% |
| All Japonica | 1512 | 0.60% | 68.80% | 0.00% | 0.00% | G: 30.56% |
| Aus | 269 | 62.80% | 0.40% | 9.67% | 0.00% | G: 27.14% |
| Indica I | 595 | 75.80% | 0.00% | 12.77% | 0.00% | G: 11.43% |
| Indica II | 465 | 80.90% | 1.70% | 4.30% | 0.00% | G: 13.12% |
| Indica III | 913 | 82.70% | 0.00% | 0.55% | 0.00% | G: 16.76% |
| Indica Intermediate | 786 | 77.40% | 1.30% | 5.60% | 0.00% | G: 15.78% |
| Temperate Japonica | 767 | 0.30% | 46.70% | 0.00% | 0.00% | G: 53.06% |
| Tropical Japonica | 504 | 0.80% | 95.80% | 0.00% | 0.00% | G: 3.37% |
| Japonica Intermediate | 241 | 1.20% | 83.00% | 0.00% | 0.00% | G: 15.77% |
| VI/Aromatic | 96 | 1.00% | 25.00% | 0.00% | 0.00% | G: 73.96% |
| Intermediate | 90 | 33.30% | 32.20% | 5.56% | 0.00% | G: 27.78%; GGACTTGGAGTTGT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014284779 | G -> C | LOC_Os10g27090.1 | downstream_gene_variant ; 1465.0bp to feature; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> C | LOC_Os10g27110.1 | downstream_gene_variant ; 4216.0bp to feature; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> C | LOC_Os10g27100.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> GGATTTGGAGTTAT | LOC_Os10g27090.1 | downstream_gene_variant ; 1466.0bp to feature; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> GGATTTGGAGTTAT | LOC_Os10g27110.1 | downstream_gene_variant ; 4215.0bp to feature; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> GGATTTGGAGTTAT | LOC_Os10g27100.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> GGACTTGGAGTTGT | LOC_Os10g27090.1 | downstream_gene_variant ; 1466.0bp to feature; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> GGACTTGGAGTTGT | LOC_Os10g27110.1 | downstream_gene_variant ; 4215.0bp to feature; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| vg1014284779 | G -> GGACTTGGAGTTGT | LOC_Os10g27100.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.128; most accessible tissue: Callus, score: 67.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014284779 | 7.88E-06 | 7.88E-06 | mr1609 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 8.53E-21 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 2.76E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | 4.23E-06 | NA | mr1891 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 8.12E-14 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 2.35E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 4.83E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 1.12E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014284779 | NA | 1.79E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |