\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014284779:

Variant ID: vg1014284779 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 14284779
Reference Allele: GAlternative Allele: GGATTTGGAGTTAT,C,GGACTTGGAGTTGT
Primary Allele: GGATTTGGAGTTATSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCCACGATATGTAGTCCAATTTGCCATTCACTCTTATTTTTTATTTTAATTGTTAGAGTTTATGTCGAATATGTGTATATAGTCGGTTACAGTTTA[G/GGATTTGGAGTTAT,C,GGACTTGGAGTTGT]
AAATTGGAATAGAGTAAGAGTCGGACTCTATCCTTGGATCTCTCTTAAATAGAGAGGTGGACCTGTTGTAACTGCATGGTGACTTAGCATAGCGAGAGGG

Reverse complement sequence

CCCTCTCGCTATGCTAAGTCACCATGCAGTTACAACAGGTCCACCTCTCTATTTAAGAGAGATCCAAGGATAGAGTCCGACTCTTACTCTATTCCAATTT[C/ATAACTCCAAATCC,G,ACAACTCCAAGTCC]
TAAACTGTAACCGACTATATACACATATTCGACATAAACTCTAACAATTAAAATAAAAAATAAGAGTGAATGGCAAATTGGACTACATATCGTGGACTAA

Allele Frequencies:

Populations Population SizeFrequency of GGATTTGGAGTTAT(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 23.60% 3.72% 0.00% G: 21.94%; GGACTTGGAGTTGT: 0.02%
All Indica  2759 79.40% 0.70% 5.26% 0.00% G: 14.72%
All Japonica  1512 0.60% 68.80% 0.00% 0.00% G: 30.56%
Aus  269 62.80% 0.40% 9.67% 0.00% G: 27.14%
Indica I  595 75.80% 0.00% 12.77% 0.00% G: 11.43%
Indica II  465 80.90% 1.70% 4.30% 0.00% G: 13.12%
Indica III  913 82.70% 0.00% 0.55% 0.00% G: 16.76%
Indica Intermediate  786 77.40% 1.30% 5.60% 0.00% G: 15.78%
Temperate Japonica  767 0.30% 46.70% 0.00% 0.00% G: 53.06%
Tropical Japonica  504 0.80% 95.80% 0.00% 0.00% G: 3.37%
Japonica Intermediate  241 1.20% 83.00% 0.00% 0.00% G: 15.77%
VI/Aromatic  96 1.00% 25.00% 0.00% 0.00% G: 73.96%
Intermediate  90 33.30% 32.20% 5.56% 0.00% G: 27.78%; GGACTTGGAGTTGT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014284779 G -> C LOC_Os10g27090.1 downstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> C LOC_Os10g27110.1 downstream_gene_variant ; 4216.0bp to feature; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> C LOC_Os10g27100.1 intron_variant ; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> GGATTTGGAGTTAT LOC_Os10g27090.1 downstream_gene_variant ; 1466.0bp to feature; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> GGATTTGGAGTTAT LOC_Os10g27110.1 downstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> GGATTTGGAGTTAT LOC_Os10g27100.1 intron_variant ; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> GGACTTGGAGTTGT LOC_Os10g27090.1 downstream_gene_variant ; 1466.0bp to feature; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> GGACTTGGAGTTGT LOC_Os10g27110.1 downstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N
vg1014284779 G -> GGACTTGGAGTTGT LOC_Os10g27100.1 intron_variant ; MODIFIER silent_mutation Average:26.128; most accessible tissue: Callus, score: 67.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014284779 7.88E-06 7.88E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 8.53E-21 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 2.76E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 4.23E-06 NA mr1891 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 8.12E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 2.35E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 4.83E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 1.12E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014284779 NA 1.79E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251