Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014199230:

Variant ID: vg1014199230 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14199230
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACCGGCAGCTAGGCCCGGTTAGACCGCAGGGACAGCGGCGGTCAGACCGGCCTCGGGGTGATTTTGTGCGTAATTCAAATCAGTCTTTTGTGAAACGA[A/C]
AAGGTAAGTTTTCAGGTATGTCTGGTTCTGATTTTGTTAGTGCATATGTACCTACTGGTTCTACTGGTCGTGTGACTCAGTGTTGGATTCCAAAATTTCT

Reverse complement sequence

AGAAATTTTGGAATCCAACACTGAGTCACACGACCAGTAGAACCAGTAGGTACATATGCACTAACAAAATCAGAACCAGACATACCTGAAAACTTACCTT[T/G]
TCGTTTCACAAAAGACTGATTTGAATTACGCACAAAATCACCCCGAGGCCGGTCTGACCGCCGCTGTCCCTGCGGTCTAACCGGGCCTAGCTGCCGGTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	0.50%	18.75%	40.37%	NA
All Indica	2759	8.70%	0.70%	23.67%	66.94%	NA
All Japonica	1512	99.40%	0.00%	0.07%	0.53%	NA
Aus	269	4.50%	1.90%	81.78%	11.90%	NA
Indica I	595	6.10%	0.00%	17.82%	76.13%	NA
Indica II	465	6.90%	0.40%	21.08%	71.61%	NA
Indica III	913	8.80%	1.60%	30.12%	59.47%	NA
Indica Intermediate	786	11.60%	0.40%	22.14%	65.90%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	65.60%	0.00%	13.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014199230	A -> C	LOC_Os10g26960.1	downstream_gene_variant ; 803.0bp to feature; MODIFIER	silent_mutation	Average:14.757; most accessible tissue: Callus, score: 42.846	N	N	N	N
vg1014199230	A -> C	LOC_Os10g26960-LOC_Os10g26980	intergenic_region ; MODIFIER	silent_mutation	Average:14.757; most accessible tissue: Callus, score: 42.846	N	N	N	N
vg1014199230	A -> DEL	N	N	silent_mutation	Average:14.757; most accessible tissue: Callus, score: 42.846	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014199230	NA	9.94E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	2.11E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	5.79E-10	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	4.81E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	4.55E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	1.08E-43	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	5.26E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	4.88E-35	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	3.14E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	1.62E-39	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	4.15E-27	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	5.58E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	6.92E-23	mr1754	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	3.93E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	7.78E-35	mr1944	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	1.61E-32	mr1081_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	7.66E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	5.97E-23	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	4.74E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	3.29E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	1.28E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	3.16E-20	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	1.20E-21	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	2.43E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014199230	NA	1.21E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251