| Variant ID: vg1014151655 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14151655 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTGGGACATCGTAGGTTTTTGCACAAAATCACAGTTTCCGATTTGATGAAAAATCATTTGATGGAACTAAAGAGCTTAGAGATGCTCCAGTTCAACCTT[C/A]
TGGACATGATATTTTGAAAGAGACAGAGAATCTGAATGTTGTTTTTGGGAAAGCTAAGAAGAAGAAGCGTAAACGTAAGGATGATGATAATAATGATGGT
ACCATCATTATTATCATCATCCTTACGTTTACGCTTCTTCTTCTTAGCTTTCCCAAAAACAACATTCAGATTCTCTGTCTCTTTCAAAATATCATGTCCA[G/T]
AAGGTTGAACTGGAGCATCTCTAAGCTCTTTAGTTCCATCAAATGATTTTTCATCAAATCGGAAACTGTGATTTTGTGCAAAAACCTACGATGTCCCAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 0.60% | 1.86% | 2.37% | NA |
| All Indica | 2759 | 93.50% | 1.00% | 2.86% | 2.68% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
| Aus | 269 | 88.50% | 0.00% | 2.60% | 8.92% | NA |
| Indica I | 595 | 98.00% | 0.50% | 0.34% | 1.18% | NA |
| Indica II | 465 | 94.80% | 1.30% | 3.44% | 0.43% | NA |
| Indica III | 913 | 92.40% | 1.00% | 3.72% | 2.85% | NA |
| Indica Intermediate | 786 | 90.50% | 1.10% | 3.44% | 4.96% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014151655 | C -> A | LOC_Os10g26890-LOC_Os10g26920 | intergenic_region ; MODIFIER | silent_mutation | Average:8.668; most accessible tissue: Callus, score: 22.145 | N | N | N | N |
| vg1014151655 | C -> DEL | N | N | silent_mutation | Average:8.668; most accessible tissue: Callus, score: 22.145 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014151655 | NA | 2.49E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014151655 | NA | 7.84E-06 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014151655 | 7.12E-06 | NA | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014151655 | 1.56E-06 | NA | mr1746_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |