\
| Variant ID: vg1014079049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14079049 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATATCAGCAATTTGCAACTTGGTGTCCAAAAACTGTAACTCAACATCTCCTTTCTCAACATGATCCCTCAAAAAATGAAAACGAATATCAATGTGCTTT[G/A]
TGCGTGAGTGTTGAACAGGATTCTTAGCAATATTGATAGCACTAGTATTATCACAAAAGAGAGGTACTTTCTCAAAAGTAATACCATAATCTTTCAAAGT
ACTTTGAAAGATTATGGTATTACTTTTGAGAAAGTACCTCTCTTTTGTGATAATACTAGTGCTATCAATATTGCTAAGAATCCTGTTCAACACTCACGCA[C/T]
AAAGCACATTGATATTCGTTTTCATTTTTTGAGGGATCATGTTGAGAAAGGAGATGTTGAGTTACAGTTTTTGGACACCAAGTTGCAAATTGCTGATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.10% | 24.40% | 27.85% | 9.65% | NA |
| All Indica | 2759 | 4.80% | 32.70% | 46.21% | 16.24% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.20% | 0.20% | NA |
| Aus | 269 | 4.10% | 88.80% | 7.06% | 0.00% | NA |
| Indica I | 595 | 2.20% | 45.90% | 27.90% | 24.03% | NA |
| Indica II | 465 | 6.70% | 12.90% | 58.06% | 22.37% | NA |
| Indica III | 913 | 4.20% | 39.90% | 48.52% | 7.45% | NA |
| Indica Intermediate | 786 | 6.50% | 26.20% | 50.38% | 16.92% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 10.00% | 21.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014079049 | G -> A | LOC_Os10g26830.1 | missense_variant ; p.Thr1360Ile; MODERATE | nonsynonymous_codon ; T1360I | Average:7.718; most accessible tissue: Callus, score: 14.864 | benign |
1.162 |
DELETERIOUS | 0.01 |
| vg1014079049 | G -> DEL | LOC_Os10g26830.1 | N | frameshift_variant | Average:7.718; most accessible tissue: Callus, score: 14.864 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014079049 | 8.67E-07 | 1.06E-09 | mr1707_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014079049 | NA | 8.48E-08 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014079049 | NA | 3.91E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |