\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014025113:

Variant ID: vg1014025113 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14025113
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAATGACCTGAAGCCAGGTGCCACCTACTAGGCGCCGGTGCTTGTACTCCCCGCCTCCCGTCGCCCATCATCTGAACCGAGCCGAGGCGGCAGCTCCC[T/C]
GGCCGCCACGCTCCGCCTCGCTCCTTCCCACCTCTCTCTCGCCGTTGCTTCCCAGATCCAGCGGAGCCCCAATGCCGAGGCGGCGCAGGACTAGGCGAGG

Reverse complement sequence

CCTCGCCTAGTCCTGCGCCGCCTCGGCATTGGGGCTCCGCTGGATCTGGGAAGCAACGGCGAGAGAGAGGTGGGAAGGAGCGAGGCGGAGCGTGGCGGCC[A/G]
GGGAGCTGCCGCCTCGGCTCGGTTCAGATGATGGGCGACGGGAGGCGGGGAGTACAAGCACCGGCGCCTAGTAGGTGGCACCTGGCTTCAGGTCATTTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.90% 0.11% 0.00% NA
All Indica  2759 42.60% 57.20% 0.18% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 58.80% 41.20% 0.00% 0.00% NA
Indica II  465 37.80% 61.70% 0.43% 0.00% NA
Indica III  913 35.50% 64.40% 0.11% 0.00% NA
Indica Intermediate  786 41.30% 58.40% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014025113 T -> C LOC_Os10g26780-LOC_Os10g26800 intergenic_region ; MODIFIER silent_mutation Average:63.363; most accessible tissue: Minghui63 young leaf, score: 77.654 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014025113 NA 2.12E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 NA 6.30E-08 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 NA 5.26E-07 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 NA 1.99E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 NA 4.22E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 NA 5.31E-06 mr1780 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 1.32E-06 6.35E-07 mr1792 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 5.35E-06 4.03E-08 mr1792 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014025113 NA 1.47E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251