\
| Variant ID: vg1014025113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14025113 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 96. )
GGAAATGACCTGAAGCCAGGTGCCACCTACTAGGCGCCGGTGCTTGTACTCCCCGCCTCCCGTCGCCCATCATCTGAACCGAGCCGAGGCGGCAGCTCCC[T/C]
GGCCGCCACGCTCCGCCTCGCTCCTTCCCACCTCTCTCTCGCCGTTGCTTCCCAGATCCAGCGGAGCCCCAATGCCGAGGCGGCGCAGGACTAGGCGAGG
CCTCGCCTAGTCCTGCGCCGCCTCGGCATTGGGGCTCCGCTGGATCTGGGAAGCAACGGCGAGAGAGAGGTGGGAAGGAGCGAGGCGGAGCGTGGCGGCC[A/G]
GGGAGCTGCCGCCTCGGCTCGGTTCAGATGATGGGCGACGGGAGGCGGGGAGTACAAGCACCGGCGCCTAGTAGGTGGCACCTGGCTTCAGGTCATTTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 39.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 42.60% | 57.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.80% | 41.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 37.80% | 61.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 35.50% | 64.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 41.30% | 58.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014025113 | T -> C | LOC_Os10g26780-LOC_Os10g26800 | intergenic_region ; MODIFIER | silent_mutation | Average:63.363; most accessible tissue: Minghui63 young leaf, score: 77.654 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014025113 | NA | 2.12E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | NA | 6.30E-08 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | NA | 5.26E-07 | mr1577 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | NA | 1.99E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | NA | 4.22E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | NA | 5.31E-06 | mr1780 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | 1.32E-06 | 6.35E-07 | mr1792 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | 5.35E-06 | 4.03E-08 | mr1792 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014025113 | NA | 1.47E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |