\
| Variant ID: vg1014024679 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14024679 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 108. )
ACCACAACAAATAAGCTACCCAACTTCTTAACTGTTTTCTCTAAAACAATACAACGCACTAATTGAATTTCTCATGTTTAAGAGGTGTATAGACAAGAAG[T/A]
CCTAAAGTCATGTGATGCTTTCATGTTCGACCTTGCTGGAGTTGTTTAGTGGCCAAATAATGAAATATGAGCAAGTGCTTTTCAGAAATGCTTCCTTCTT
AAGAAGGAAGCATTTCTGAAAAGCACTTGCTCATATTTCATTATTTGGCCACTAAACAACTCCAGCAAGGTCGAACATGAAAGCATCACATGACTTTAGG[A/T]
CTTCTTGTCTATACACCTCTTAAACATGAGAAATTCAATTAGTGCGTTGTATTGTTTTAGAGAAAACAGTTAAGAAGTTGGGTAGCTTATTTGTTGTGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.10% | 23.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 59.40% | 40.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 42.70% | 57.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 65.80% | 34.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 64.80% | 35.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 61.80% | 38.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014024679 | T -> A | LOC_Os10g26780-LOC_Os10g26800 | intergenic_region ; MODIFIER | silent_mutation | Average:46.43; most accessible tissue: Callus, score: 79.312 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014024679 | NA | 4.37E-06 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014024679 | 6.44E-06 | NA | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014024679 | 9.55E-06 | 1.65E-07 | mr1577 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014024679 | NA | 2.02E-07 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014024679 | NA | 1.21E-06 | mr1780 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014024679 | 8.19E-07 | 6.81E-09 | mr1792 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014024679 | 6.55E-06 | 4.92E-08 | mr1792 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |