\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013810037:

Variant ID: vg1013810037 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13810037
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TACGGAGTACAATGTATCTTGTAGATAACTAGAGCTAGCTATGCTGCACCCGGATGTATACGTACTCCCTCCGTTTCAGGTTATAGGAGTTTGACTAATT[T/C]
TATAGAAAAATATAGTAATATTTACAATATGTTATTAACATAGTTTAATAATATATTTGTCTTGGGTTAAAAATATTACTATTTTTTTCTATAAAATTAG

Reverse complement sequence

CTAATTTTATAGAAAAAAATAGTAATATTTTTAACCCAAGACAAATATATTATTAAACTATGTTAATAACATATTGTAAATATTACTATATTTTTCTATA[A/G]
AATTAGTCAAACTCCTATAACCTGAAACGGAGGGAGTACGTATACATCCGGGTGCAGCATAGCTAGCTCTAGTTATCTACAAGATACATTGTACTCCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.40% 0.00% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 39.70% 60.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 6.80% 93.20% 0.00% 0.00% NA
Tropical Japonica  504 77.00% 23.00% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 33.20% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013810037 T -> C LOC_Os10g26500.1 downstream_gene_variant ; 3305.0bp to feature; MODIFIER silent_mutation Average:71.127; most accessible tissue: Callus, score: 92.62 N N N N
vg1013810037 T -> C LOC_Os10g26510.1 downstream_gene_variant ; 1992.0bp to feature; MODIFIER silent_mutation Average:71.127; most accessible tissue: Callus, score: 92.62 N N N N
vg1013810037 T -> C LOC_Os10g26500-LOC_Os10g26510 intergenic_region ; MODIFIER silent_mutation Average:71.127; most accessible tissue: Callus, score: 92.62 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013810037 6.47E-07 4.82E-42 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 4.09E-06 6.29E-14 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 2.42E-06 1.14E-37 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 5.97E-15 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 3.31E-22 mr1156_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 3.56E-10 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 5.06E-08 5.57E-45 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 2.39E-06 1.77E-19 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 5.27E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 1.23E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 9.70E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 1.31E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 2.99E-08 8.11E-25 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013810037 NA 1.37E-10 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251