Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013800782:

Variant ID: vg1013800782 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13800782
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TATATATATACATTGTGAATGCACTAGCAAGCTTAGGATAGTTATTAGCAACTAATTTTTTTATGAAGCTATTAACAACTAATCATAGGGCTCTCAAGAG[G/A]
GGGGTTAGGTTCCCTAGAAGAATGTTAAGCTTTTCAGAGACCAAGTTAATTACATATGATTGTGTCATCATCAGCAGTCATGCATGAATTGGTAATCATA

Reverse complement sequence

TATGATTACCAATTCATGCATGACTGCTGATGATGACACAATCATATGTAATTAACTTGGTCTCTGAAAAGCTTAACATTCTTCTAGGGAACCTAACCCC[C/T]
CTCTTGAGAGCCCTATGATTAGTTGTTAATAGCTTCATAAAAAAATTAGTTGCTAATAACTATCCTAAGCTTGCTAGTGCATTCACAATGTATATATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 35.00% 0.21% 0.00% NA
All Indica  2759 62.10% 37.60% 0.33% 0.00% NA
All Japonica  1512 63.20% 36.70% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.80% 3.00% 0.17% 0.00% NA
Indica II  465 35.10% 64.70% 0.22% 0.00% NA
Indica III  913 56.50% 43.40% 0.11% 0.00% NA
Indica Intermediate  786 58.10% 41.10% 0.76% 0.00% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 30.40% 69.40% 0.20% 0.00% NA
Japonica Intermediate  241 35.70% 64.30% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013800782 G -> A LOC_Os10g26500.1 upstream_gene_variant ; 4029.0bp to feature; MODIFIER silent_mutation Average:68.491; most accessible tissue: Callus, score: 98.909 N N N N
vg1013800782 G -> A LOC_Os10g26490-LOC_Os10g26500 intergenic_region ; MODIFIER silent_mutation Average:68.491; most accessible tissue: Callus, score: 98.909 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013800782 G A -0.1 -0.03 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013800782 NA 7.31E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013800782 NA 3.53E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013800782 4.65E-06 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 5.99E-06 7.81E-15 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 7.15E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 1.48E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 5.48E-16 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 1.36E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 5.46E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 1.06E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 2.97E-10 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 2.33E-09 1.13E-23 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 7.43E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 8.08E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 4.31E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 9.22E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 NA 2.84E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 1.56E-08 NA mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013800782 1.69E-07 1.87E-13 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251