\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013793084:

Variant ID: vg1013793084 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13793084
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAAGCTCCGCCTCGGACCTCCACCTCGTCATCGGGTGCGGCGGTGGTGGCGGTGGCGACAGACCCTCTCGAGGTGGCGGATCTCAGCCGGACTCACT[G/A]
GCCGCTTGTCACCCATCTGCCACCGGCAACCTCCCAAGAAGAGAAGCAAGGAGAGAAGAGAAGAGAATAAAGAAGAGCTGTGGGTCCCATATTTTTTTCT

Reverse complement sequence

AGAAAAAAATATGGGACCCACAGCTCTTCTTTATTCTCTTCTCTTCTCTCCTTGCTTCTCTTCTTGGGAGGTTGCCGGTGGCAGATGGGTGACAAGCGGC[C/T]
AGTGAGTCCGGCTGAGATCCGCCACCTCGAGAGGGTCTGTCGCCACCGCCACCACCGCCGCACCCGATGACGAGGTGGAGGTCCGAGGCGGAGCTTTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.50% 20.40% 0.15% 0.00% NA
All Indica  2759 98.00% 1.90% 0.04% 0.00% NA
All Japonica  1512 63.00% 36.70% 0.26% 0.00% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.10% 0.13% 0.00% NA
Temperate Japonica  767 93.60% 6.40% 0.00% 0.00% NA
Tropical Japonica  504 30.00% 69.60% 0.40% 0.00% NA
Japonica Intermediate  241 34.90% 64.30% 0.83% 0.00% NA
VI/Aromatic  96 4.20% 93.80% 2.08% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013793084 G -> A LOC_Os10g26490.1 downstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:55.576; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1013793084 G -> A LOC_Os10g26490-LOC_Os10g26500 intergenic_region ; MODIFIER silent_mutation Average:55.576; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013793084 NA 3.79E-16 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013793084 NA 5.89E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013793084 NA 2.72E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 2.36E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 1.91E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 6.15E-08 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 2.85E-07 3.84E-16 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 4.81E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 2.63E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 6.40E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 2.21E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 9.93E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 7.41E-16 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 1.42E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 8.20E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 1.31E-14 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 1.04E-08 NA mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 8.38E-09 4.11E-23 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 4.62E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 1.56E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 6.85E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 NA 1.83E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 6.40E-07 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013793084 8.34E-06 1.46E-11 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251