\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013767614:

Variant ID: vg1013767614 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13767614
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATAAGTAGACCGGTACGTGAATTTGACAATCATGTGCATTTTAGGCCAAAACACTAATACATATATTTGATTAATCTTGGTATTATAAGCTTTGCT[A/C]
GATCGTTGGCTCATGGATTCATTTTTGTGTTTCACCATGTTTATAACCCGGGATAATGAATATGTTGATTAGTCATGCACTTACTTTTGATAATCATATA

Reverse complement sequence

TATATGATTATCAAAAGTAAGTGCATGACTAATCAACATATTCATTATCCCGGGTTATAAACATGGTGAAACACAAAAATGAATCCATGAGCCAACGATC[T/G]
AGCAAAGCTTATAATACCAAGATTAATCAAATATATGTATTAGTGTTTTGGCCTAAAATGCACATGATTGTCAAATTCACGTACCGGTCTACTTATTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 9.90% 0.99% 0.00% NA
All Indica  2759 81.40% 17.00% 1.67% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 71.90% 23.20% 4.87% 0.00% NA
Indica II  465 89.90% 9.90% 0.22% 0.00% NA
Indica III  913 86.00% 14.00% 0.00% 0.00% NA
Indica Intermediate  786 78.10% 19.80% 2.04% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013767614 A -> C LOC_Os10g26440.1 upstream_gene_variant ; 1943.0bp to feature; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1013767614 A -> C LOC_Os10g26430.1 downstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1013767614 A -> C LOC_Os10g26450.1 downstream_gene_variant ; 950.0bp to feature; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1013767614 A -> C LOC_Os10g26450-LOC_Os10g26460 intergenic_region ; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013767614 1.74E-07 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614 6.25E-08 3.98E-11 mr1533 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614 2.10E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614 9.46E-07 2.54E-09 mr1980 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614 9.92E-08 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614 3.51E-08 1.22E-13 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614 NA 8.19E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251