\
| Variant ID: vg1013767614 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13767614 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 259. )
AAAAATAAGTAGACCGGTACGTGAATTTGACAATCATGTGCATTTTAGGCCAAAACACTAATACATATATTTGATTAATCTTGGTATTATAAGCTTTGCT[A/C]
GATCGTTGGCTCATGGATTCATTTTTGTGTTTCACCATGTTTATAACCCGGGATAATGAATATGTTGATTAGTCATGCACTTACTTTTGATAATCATATA
TATATGATTATCAAAAGTAAGTGCATGACTAATCAACATATTCATTATCCCGGGTTATAAACATGGTGAAACACAAAAATGAATCCATGAGCCAACGATC[T/G]
AGCAAAGCTTATAATACCAAGATTAATCAAATATATGTATTAGTGTTTTGGCCTAAAATGCACATGATTGTCAAATTCACGTACCGGTCTACTTATTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 9.90% | 0.99% | 0.00% | NA |
| All Indica | 2759 | 81.40% | 17.00% | 1.67% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 23.20% | 4.87% | 0.00% | NA |
| Indica II | 465 | 89.90% | 9.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.10% | 19.80% | 2.04% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013767614 | A -> C | LOC_Os10g26440.1 | upstream_gene_variant ; 1943.0bp to feature; MODIFIER | silent_mutation | Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1013767614 | A -> C | LOC_Os10g26430.1 | downstream_gene_variant ; 4215.0bp to feature; MODIFIER | silent_mutation | Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1013767614 | A -> C | LOC_Os10g26450.1 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1013767614 | A -> C | LOC_Os10g26450-LOC_Os10g26460 | intergenic_region ; MODIFIER | silent_mutation | Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013767614 | 1.74E-07 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013767614 | 6.25E-08 | 3.98E-11 | mr1533 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013767614 | 2.10E-06 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013767614 | 9.46E-07 | 2.54E-09 | mr1980 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013767614 | 9.92E-08 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013767614 | 3.51E-08 | 1.22E-13 | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013767614 | NA | 8.19E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |