\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013737644:

Variant ID: vg1013737644 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13737644
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TAAACCATTCAAAATTTCATTGAGTATCAATTTGTTAAGTTGTTTATTAATTTCATATATTGATACGTCATTATTTTTCGAACGATAGCGTATTCACATG[G/A]
GGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAATCCTTAATCCCGACGGTGAATTCTACTA

Reverse complement sequence

TAGTAGAATTCACCGTCGGGATTAAGGATTTCTTCGTTGATGAATCCCATCAGTTGTTCTTGAACAGCCGTGATAAAATCCTTGTGTGGGAGATTATCCC[C/T]
CATGTGAATACGCTATCGTTCGAAAAATAATGACGTATCAATATATGAAATTAATAAACAACTTAACAAATTGATACTCAATGAAATTTTGAATGGTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 19.70% 16.27% 4.19% NA
All Indica  2759 75.80% 0.90% 16.64% 6.63% NA
All Japonica  1512 38.20% 58.30% 2.71% 0.79% NA
Aus  269 9.30% 0.00% 90.33% 0.37% NA
Indica I  595 67.90% 0.00% 15.29% 16.81% NA
Indica II  465 89.90% 2.80% 6.45% 0.86% NA
Indica III  913 79.10% 0.10% 20.04% 0.77% NA
Indica Intermediate  786 69.70% 1.40% 19.72% 9.16% NA
Temperate Japonica  767 6.40% 93.40% 0.26% 0.00% NA
Tropical Japonica  504 73.60% 17.30% 6.94% 2.18% NA
Japonica Intermediate  241 65.60% 32.40% 1.66% 0.41% NA
VI/Aromatic  96 88.50% 1.00% 10.42% 0.00% NA
Intermediate  90 51.10% 28.90% 17.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013737644 G -> A LOC_Os10g26420.1 missense_variant ; p.Gly1446Arg; MODERATE nonsynonymous_codon ; G1446R Average:14.14; most accessible tissue: Zhenshan97 panicle, score: 32.308 benign -0.875 TOLERATED 1.00
vg1013737644 G -> DEL LOC_Os10g26420.1 N frameshift_variant Average:14.14; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013737644 NA 1.17E-13 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013737644 NA 3.24E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013737644 NA 4.31E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 2.20E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 8.04E-06 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 3.55E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 6.21E-07 3.67E-46 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 2.14E-12 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 1.29E-06 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 7.41E-06 8.42E-43 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 8.78E-14 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 6.45E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 1.82E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 2.66E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 1.74E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 5.72E-10 6.52E-57 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 2.07E-06 5.43E-20 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 5.57E-06 2.42E-12 mr1660_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 1.31E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 5.62E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 5.33E-10 1.94E-29 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013737644 NA 1.66E-10 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251