\
| Variant ID: vg1013737644 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13737644 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 97. )
TAAACCATTCAAAATTTCATTGAGTATCAATTTGTTAAGTTGTTTATTAATTTCATATATTGATACGTCATTATTTTTCGAACGATAGCGTATTCACATG[G/A]
GGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAATCCTTAATCCCGACGGTGAATTCTACTA
TAGTAGAATTCACCGTCGGGATTAAGGATTTCTTCGTTGATGAATCCCATCAGTTGTTCTTGAACAGCCGTGATAAAATCCTTGTGTGGGAGATTATCCC[C/T]
CATGTGAATACGCTATCGTTCGAAAAATAATGACGTATCAATATATGAAATTAATAAACAACTTAACAAATTGATACTCAATGAAATTTTGAATGGTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 19.70% | 16.27% | 4.19% | NA |
| All Indica | 2759 | 75.80% | 0.90% | 16.64% | 6.63% | NA |
| All Japonica | 1512 | 38.20% | 58.30% | 2.71% | 0.79% | NA |
| Aus | 269 | 9.30% | 0.00% | 90.33% | 0.37% | NA |
| Indica I | 595 | 67.90% | 0.00% | 15.29% | 16.81% | NA |
| Indica II | 465 | 89.90% | 2.80% | 6.45% | 0.86% | NA |
| Indica III | 913 | 79.10% | 0.10% | 20.04% | 0.77% | NA |
| Indica Intermediate | 786 | 69.70% | 1.40% | 19.72% | 9.16% | NA |
| Temperate Japonica | 767 | 6.40% | 93.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 73.60% | 17.30% | 6.94% | 2.18% | NA |
| Japonica Intermediate | 241 | 65.60% | 32.40% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 88.50% | 1.00% | 10.42% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 28.90% | 17.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013737644 | G -> A | LOC_Os10g26420.1 | missense_variant ; p.Gly1446Arg; MODERATE | nonsynonymous_codon ; G1446R | Average:14.14; most accessible tissue: Zhenshan97 panicle, score: 32.308 | benign |
-0.875 |
TOLERATED | 1.00 |
| vg1013737644 | G -> DEL | LOC_Os10g26420.1 | N | frameshift_variant | Average:14.14; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013737644 | NA | 1.17E-13 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1013737644 | NA | 3.24E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1013737644 | NA | 4.31E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 2.20E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 8.04E-06 | NA | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 3.55E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 6.21E-07 | 3.67E-46 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 2.14E-12 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 1.29E-06 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 7.41E-06 | 8.42E-43 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 8.78E-14 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 6.45E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 1.82E-18 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 2.66E-09 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 1.74E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 5.72E-10 | 6.52E-57 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 2.07E-06 | 5.43E-20 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 5.57E-06 | 2.42E-12 | mr1660_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 1.31E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 5.62E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | 5.33E-10 | 1.94E-29 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013737644 | NA | 1.66E-10 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |