\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013736780:

Variant ID: vg1013736780 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13736780
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGAGCGCATGGATTTTGTGAGTATCTTTGAGTTCGATTTGTTTCGTTCAATAATTAGCTTCTGGCATATATGTAAGCAATAATACTTTCCTTTCATC[A/G]
TTGTAGAATGGAGATTCAAAGTGCCCGACGGCGGTGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAG

Reverse complement sequence

CTCGTACTTGTCGATCATTTCGGTGTTGATTTTCCGAGGGTCGATGAACCCAGTATCGTAGACCCACCGCCGTCGGGCACTTTGAATCTCCATTCTACAA[T/C]
GATGAAAGGAAAGTATTATTGCTTACATATATGCCAGAAGCTAATTATTGAACGAAACAAATCGAACTCAAAGATACTCACAAAATCCATGCGCTCAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 20.20% 2.71% 0.00% NA
All Indica  2759 97.60% 1.50% 0.87% 0.00% NA
All Japonica  1512 39.30% 58.30% 2.45% 0.00% NA
Aus  269 82.90% 1.10% 15.99% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 96.60% 2.80% 0.65% 0.00% NA
Indica III  913 97.90% 0.80% 1.31% 0.00% NA
Indica Intermediate  786 96.80% 2.20% 1.02% 0.00% NA
Temperate Japonica  767 6.50% 93.40% 0.13% 0.00% NA
Tropical Japonica  504 76.80% 17.30% 5.95% 0.00% NA
Japonica Intermediate  241 65.10% 32.40% 2.49% 0.00% NA
VI/Aromatic  96 79.20% 2.10% 18.75% 0.00% NA
Intermediate  90 62.20% 31.10% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013736780 A -> G LOC_Os10g26420.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:16.821; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013736780 NA 1.10E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013736780 NA 2.57E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013736780 NA 1.61E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 7.58E-42 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 2.88E-13 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 4.65E-37 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 6.46E-13 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 1.01E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 9.40E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 9.88E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 1.77E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 7.60E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 3.01E-06 3.00E-06 mr1413_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 1.51E-10 2.03E-54 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 7.66E-09 1.20E-22 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 2.97E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 2.57E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 9.25E-06 5.01E-12 mr1660_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 9.87E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 1.15E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 3.29E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 1.79E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 NA 1.89E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 7.51E-10 1.14E-28 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013736780 2.86E-06 6.56E-12 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251