\
| Variant ID: vg1013723877 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13723877 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
TAGCCATATCACTTTTTCAGTGTCCAACAGAAAAGAGAACAAACTTTAATTAAGTGTTTGCCATGTCACCTTTTTAGTGTCCAACAATAAAGACCACATG[G/T]
ATTTTTTTTAGAAACACGGTACAAACGCAAGAGCTCACAACACGCTTAAACTCACCGATCTATAAATGCACACATGCATGCCCTATCCATATATATAAGC
GCTTATATATATGGATAGGGCATGCATGTGTGCATTTATAGATCGGTGAGTTTAAGCGTGTTGTGAGCTCTTGCGTTTGTACCGTGTTTCTAAAAAAAAT[C/A]
CATGTGGTCTTTATTGTTGGACACTAAAAAGGTGACATGGCAAACACTTAATTAAAGTTTGTTCTCTTTTCTGTTGGACACTGAAAAAGTGATATGGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 6.90% | 25.62% | 32.08% | NA |
| All Indica | 2759 | 17.10% | 0.10% | 34.61% | 48.17% | NA |
| All Japonica | 1512 | 58.00% | 21.00% | 11.64% | 9.33% | NA |
| Aus | 269 | 95.90% | 0.00% | 2.60% | 1.49% | NA |
| Indica I | 595 | 10.10% | 0.00% | 42.69% | 47.23% | NA |
| Indica II | 465 | 11.60% | 0.00% | 33.55% | 54.84% | NA |
| Indica III | 913 | 24.50% | 0.00% | 29.79% | 45.67% | NA |
| Indica Intermediate | 786 | 17.00% | 0.40% | 34.73% | 47.84% | NA |
| Temperate Japonica | 767 | 92.80% | 5.10% | 1.96% | 0.13% | NA |
| Tropical Japonica | 504 | 11.90% | 43.10% | 22.02% | 23.02% | NA |
| Japonica Intermediate | 241 | 43.60% | 25.70% | 20.75% | 9.96% | NA |
| VI/Aromatic | 96 | 29.20% | 0.00% | 47.92% | 22.92% | NA |
| Intermediate | 90 | 40.00% | 7.80% | 30.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013723877 | G -> T | LOC_Os10g26410.1 | upstream_gene_variant ; 1145.0bp to feature; MODIFIER | silent_mutation | Average:46.437; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
| vg1013723877 | G -> T | LOC_Os10g26410-LOC_Os10g26420 | intergenic_region ; MODIFIER | silent_mutation | Average:46.437; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
| vg1013723877 | G -> DEL | N | N | silent_mutation | Average:46.437; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013723877 | NA | 2.58E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1013723877 | NA | 3.11E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 1.65E-08 | 5.85E-22 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 2.26E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 5.77E-10 | 5.72E-19 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 1.13E-14 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 9.95E-11 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 2.42E-09 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 2.59E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 4.54E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 3.01E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 7.42E-09 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 2.13E-06 | 9.47E-19 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 3.65E-10 | 8.53E-25 | mr1301_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 3.64E-17 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 9.62E-13 | 3.37E-22 | mr1410_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 1.28E-06 | 2.28E-16 | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 7.11E-09 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | 6.13E-07 | 6.88E-20 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 2.86E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013723877 | NA | 3.66E-07 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |