\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013692698:

Variant ID: vg1013692698 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13692698
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGCGGAGCCGTCACCATATAATCTGCTGCCACCGCCGCCGCCACGGAACATTTGTTGCTGTCACCACGGAGCCATCGCTGTCGTGTTGCTGAAGAGTT[G/A]
GAGCAGTGAAGTGTTGACGAAAATTCTACGCTTGGCCAATTGTGTCGGAATTGTGTTGACACGAACTAAGTCGACGAACACAGCAGCCTAGGAGATCTGC

Reverse complement sequence

GCAGATCTCCTAGGCTGCTGTGTTCGTCGACTTAGTTCGTGTCAACACAATTCCGACACAATTGGCCAAGCGTAGAATTTTCGTCAACACTTCACTGCTC[C/T]
AACTCTTCAGCAACACGACAGCGATGGCTCCGTGGTGACAGCAACAAATGTTCCGTGGCGGCGGCGGTGGCAGCAGATTATATGGTGACGGCTCCGCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 7.70% 1.06% 0.00% NA
All Indica  2759 87.00% 11.30% 1.70% 0.00% NA
All Japonica  1512 96.80% 3.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.60% 5.70% 4.71% 0.00% NA
Indica II  465 98.30% 1.30% 0.43% 0.00% NA
Indica III  913 80.30% 19.70% 0.00% 0.00% NA
Indica Intermediate  786 86.00% 11.80% 2.16% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 8.70% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013692698 G -> A LOC_Os10g26370.1 downstream_gene_variant ; 3816.0bp to feature; MODIFIER silent_mutation Average:57.366; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N
vg1013692698 G -> A LOC_Os10g26370-LOC_Os10g26380 intergenic_region ; MODIFIER silent_mutation Average:57.366; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013692698 NA 5.84E-09 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013692698 4.83E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013692698 NA 1.00E-11 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013692698 NA 8.35E-13 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013692698 2.91E-07 NA mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013692698 5.95E-07 5.21E-11 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251