\
| Variant ID: vg1013689775 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13689775 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
ACAACCATATTTACAATTACAAGTTCGTCACATAATAAACGGATCACATATCTCTACTATTATAAAAATTGAAGATGTTTTTATCGGTATTTTGGTACGT[C/T,G]
ATCCGTGTATGACTCGGTTTTTAAGTTCGTTTGCTTTTGGAAATATATATCCGTATTTGAGTCAGTTTTTAAGTTCGTTCGTTTATCTACTATCATAAAA
TTTTATGATAGTAGATAAACGAACGAACTTAAAAACTGACTCAAATACGGATATATATTTCCAAAAGCAAACGAACTTAAAAACCGAGTCATACACGGAT[G/A,C]
ACGTACCAAAATACCGATAAAAACATCTTCAATTTTTATAATAGTAGAGATATGTGATCCGTTTATTATGTGACGAACTTGTAATTGTAAATATGGTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 5.60% | 2.54% | 0.00% | G: 0.02% |
| All Indica | 2759 | 86.20% | 9.50% | 4.24% | 0.00% | G: 0.04% |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.40% | 35.10% | 14.45% | 0.00% | NA |
| Indica II | 465 | 96.10% | 1.70% | 2.15% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 5.70% | 2.67% | 0.00% | G: 0.13% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013689775 | C -> G | LOC_Os10g26370.1 | downstream_gene_variant ; 893.0bp to feature; MODIFIER | silent_mutation | Average:26.311; most accessible tissue: Callus, score: 60.643 | N | N | N | N |
| vg1013689775 | C -> G | LOC_Os10g26370-LOC_Os10g26380 | intergenic_region ; MODIFIER | silent_mutation | Average:26.311; most accessible tissue: Callus, score: 60.643 | N | N | N | N |
| vg1013689775 | C -> T | LOC_Os10g26370.1 | downstream_gene_variant ; 893.0bp to feature; MODIFIER | silent_mutation | Average:26.311; most accessible tissue: Callus, score: 60.643 | N | N | N | N |
| vg1013689775 | C -> T | LOC_Os10g26370-LOC_Os10g26380 | intergenic_region ; MODIFIER | silent_mutation | Average:26.311; most accessible tissue: Callus, score: 60.643 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013689775 | NA | 2.39E-10 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 3.77E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 5.51E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 3.96E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 2.43E-07 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | 3.34E-08 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | 8.84E-09 | 9.29E-07 | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 8.64E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 9.82E-08 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 2.90E-06 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 2.54E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013689775 | NA | 6.07E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |