\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013689775:

Variant ID: vg1013689775 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13689775
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACCATATTTACAATTACAAGTTCGTCACATAATAAACGGATCACATATCTCTACTATTATAAAAATTGAAGATGTTTTTATCGGTATTTTGGTACGT[C/T,G]
ATCCGTGTATGACTCGGTTTTTAAGTTCGTTTGCTTTTGGAAATATATATCCGTATTTGAGTCAGTTTTTAAGTTCGTTCGTTTATCTACTATCATAAAA

Reverse complement sequence

TTTTATGATAGTAGATAAACGAACGAACTTAAAAACTGACTCAAATACGGATATATATTTCCAAAAGCAAACGAACTTAAAAACCGAGTCATACACGGAT[G/A,C]
ACGTACCAAAATACCGATAAAAACATCTTCAATTTTTATAATAGTAGAGATATGTGATCCGTTTATTATGTGACGAACTTGTAATTGTAAATATGGTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 5.60% 2.54% 0.00% G: 0.02%
All Indica  2759 86.20% 9.50% 4.24% 0.00% G: 0.04%
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 50.40% 35.10% 14.45% 0.00% NA
Indica II  465 96.10% 1.70% 2.15% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 91.50% 5.70% 2.67% 0.00% G: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013689775 C -> G LOC_Os10g26370.1 downstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:26.311; most accessible tissue: Callus, score: 60.643 N N N N
vg1013689775 C -> G LOC_Os10g26370-LOC_Os10g26380 intergenic_region ; MODIFIER silent_mutation Average:26.311; most accessible tissue: Callus, score: 60.643 N N N N
vg1013689775 C -> T LOC_Os10g26370.1 downstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:26.311; most accessible tissue: Callus, score: 60.643 N N N N
vg1013689775 C -> T LOC_Os10g26370-LOC_Os10g26380 intergenic_region ; MODIFIER silent_mutation Average:26.311; most accessible tissue: Callus, score: 60.643 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013689775 NA 2.39E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 3.77E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 5.51E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 3.96E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 2.43E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 3.34E-08 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 8.84E-09 9.29E-07 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 8.64E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 9.82E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 2.90E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 2.54E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013689775 NA 6.07E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251