Search for Variation information by Variation ID:
Detailed information for vg1013680144:
| Variant ID: vg1013680144 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13680144 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )
Flanking Sequence (100 bp) in Reference Genome:
GGATACCACTCTGGAGTTCTTGCAATGGAAGGCAAAAAATGGTATTAGTGACAAGGCATTTGGCGATTTATTGAAACTCGTCAAGAACATTCTTCCGGAG[G/A]
GAAACAAATTGCCCGAGACAACGTACGAGGCTAAGAAGATAGTGTGCCCTTTAAGACTGGAAGTTCAGAAGATTCACGCATGTCCGAATGATTGTATCCT
Reverse complement sequence
AGGATACAATCATTCGGACATGCGTGAATCTTCTGAACTTCCAGTCTTAAAGGGCACACTATCTTCTTAGCCTCGTACGTTGTCTCGGGCAATTTGTTTC[C/T]
CTCCGGAAGAATGTTCTTGACGAGTTTCAATAAATCGCCAAATGCCTTGTCACTAATACCATTTTTTGCCTTCCATTGCAAGAACTCCAGAGTGGTATCC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.60% | 43.00% | 1.02% | 8.46% | NA |
| All Indica | 2759 | 27.70% | 71.50% | 0.76% | 0.04% | NA |
| All Japonica | 1512 | 71.90% | 0.70% | 1.52% | 25.86% | NA |
| Aus | 269 | 91.80% | 7.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 31.30% | 67.20% | 1.51% | 0.00% | NA |
| Indica II | 465 | 6.90% | 92.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 33.00% | 66.50% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 31.20% | 68.30% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 94.40% | 0.30% | 0.26% | 5.08% | NA |
| Tropical Japonica | 504 | 49.20% | 1.20% | 2.38% | 47.22% | NA |
| Japonica Intermediate | 241 | 47.70% | 1.20% | 3.73% | 47.30% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 27.80% | 4.44% | 7.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013680144 | G -> A | LOC_Os10g26370.1 | missense_variant ; p.Gly269Arg; MODERATE | nonsynonymous_codon ; G269R | Average:17.223; most accessible tissue: Zhenshan97 root, score: 23.888 | benign  |
1.107 |
DELETERIOUS | 0.01 |
| vg1013680144 | G -> DEL | LOC_Os10g26370.1 | N | frameshift_variant | Average:17.223; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013680144 | 5.48E-07 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013680144 | 1.02E-06 | 2.37E-09 | mr1533 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013680144 | NA | 1.86E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013680144 | NA | 1.18E-09 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013680144 | NA | 2.89E-07 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |