Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013655531:

Variant ID: vg1013655531 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13655531
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGAAATTCTCACATTAATTGGTGAAAAAGAAAAGAAGAGTACAAGTAGAAATACAATCTAAAAATAGCTGAAATTCGGAATTAAAAGTATGCAATATT[T/G,A]
AAAGAGGAGTCCATATAGGAACCCAATACGTGAGTAATTAAAATTCGGAATAAAAATAAAATAAATTTTGAAATTAGAAAAAGAAGAAAGAAGAGTTTGA

Reverse complement sequence

TCAAACTCTTCTTTCTTCTTTTTCTAATTTCAAAATTTATTTTATTTTTATTCCGAATTTTAATTACTCACGTATTGGGTTCCTATATGGACTCCTCTTT[A/C,T]
AATATTGCATACTTTTAATTCCGAATTTCAGCTATTTTTAGATTGTATTTCTACTTGTACTCTTCTTTTCTTTTTCACCAATTAATGTGAGAATTTCTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.50%	20.10%	0.02%	2.22%	A: 0.13%
All Indica	2759	99.20%	0.70%	0.00%	0.07%	A: 0.07%
All Japonica	1512	33.30%	59.90%	0.00%	6.68%	A: 0.07%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.40%	0.00%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.00%	0.00%	0.13%	A: 0.25%
Temperate Japonica	767	6.50%	93.40%	0.00%	0.13%	NA
Tropical Japonica	504	62.50%	18.10%	0.00%	19.44%	NA
Japonica Intermediate	241	57.70%	41.10%	0.00%	0.83%	A: 0.41%
VI/Aromatic	96	93.80%	2.10%	1.04%	0.00%	A: 3.12%
Intermediate	90	70.00%	27.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013655531	T -> G	LOC_Os10g26330.1	upstream_gene_variant ; 3837.0bp to feature; MODIFIER	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N
vg1013655531	T -> G	LOC_Os10g26340.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N
vg1013655531	T -> G	LOC_Os10g26330-LOC_Os10g26340	intergenic_region ; MODIFIER	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N
vg1013655531	T -> A	LOC_Os10g26330.1	upstream_gene_variant ; 3837.0bp to feature; MODIFIER	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N
vg1013655531	T -> A	LOC_Os10g26340.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N
vg1013655531	T -> A	LOC_Os10g26330-LOC_Os10g26340	intergenic_region ; MODIFIER	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N
vg1013655531	T -> DEL	N	N	silent_mutation	Average:23.161; most accessible tissue: Callus, score: 52.737	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013655531	NA	4.06E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	7.62E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	5.26E-74	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	3.06E-62	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	3.18E-09	2.13E-49	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	2.29E-06	1.63E-13	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	6.77E-78	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	1.19E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	4.04E-07	1.28E-44	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	5.83E-14	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	4.62E-69	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	1.70E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	1.59E-19	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	2.31E-10	mr1156_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	7.97E-55	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	9.44E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	6.55E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	6.18E-78	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	1.13E-14	2.20E-60	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	1.93E-09	8.29E-22	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	1.99E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	2.17E-10	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	5.05E-78	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	4.02E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	4.32E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	NA	8.48E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	3.32E-12	8.41E-31	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531	4.17E-06	3.60E-11	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251