\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013655531:

Variant ID: vg1013655531 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13655531
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGAAATTCTCACATTAATTGGTGAAAAAGAAAAGAAGAGTACAAGTAGAAATACAATCTAAAAATAGCTGAAATTCGGAATTAAAAGTATGCAATATT[T/G,A]
AAAGAGGAGTCCATATAGGAACCCAATACGTGAGTAATTAAAATTCGGAATAAAAATAAAATAAATTTTGAAATTAGAAAAAGAAGAAAGAAGAGTTTGA

Reverse complement sequence

TCAAACTCTTCTTTCTTCTTTTTCTAATTTCAAAATTTATTTTATTTTTATTCCGAATTTTAATTACTCACGTATTGGGTTCCTATATGGACTCCTCTTT[A/C,T]
AATATTGCATACTTTTAATTCCGAATTTCAGCTATTTTTAGATTGTATTTCTACTTGTACTCTTCTTTTCTTTTTCACCAATTAATGTGAGAATTTCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 20.10% 0.02% 2.22% A: 0.13%
All Indica  2759 99.20% 0.70% 0.00% 0.07% A: 0.07%
All Japonica  1512 33.30% 59.90% 0.00% 6.68% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.00% 0.22% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.00% 0.00% 0.13% A: 0.25%
Temperate Japonica  767 6.50% 93.40% 0.00% 0.13% NA
Tropical Japonica  504 62.50% 18.10% 0.00% 19.44% NA
Japonica Intermediate  241 57.70% 41.10% 0.00% 0.83% A: 0.41%
VI/Aromatic  96 93.80% 2.10% 1.04% 0.00% A: 3.12%
Intermediate  90 70.00% 27.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013655531 T -> G LOC_Os10g26330.1 upstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N
vg1013655531 T -> G LOC_Os10g26340.1 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N
vg1013655531 T -> G LOC_Os10g26330-LOC_Os10g26340 intergenic_region ; MODIFIER silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N
vg1013655531 T -> A LOC_Os10g26330.1 upstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N
vg1013655531 T -> A LOC_Os10g26340.1 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N
vg1013655531 T -> A LOC_Os10g26330-LOC_Os10g26340 intergenic_region ; MODIFIER silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N
vg1013655531 T -> DEL N N silent_mutation Average:23.161; most accessible tissue: Callus, score: 52.737 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013655531 NA 4.06E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 7.62E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 5.26E-74 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 3.06E-62 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 3.18E-09 2.13E-49 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 2.29E-06 1.63E-13 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 6.77E-78 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 1.19E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 4.04E-07 1.28E-44 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 5.83E-14 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 4.62E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 1.70E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 1.59E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 2.31E-10 mr1156_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 7.97E-55 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 9.44E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 6.55E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 6.18E-78 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 1.13E-14 2.20E-60 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 1.93E-09 8.29E-22 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 1.99E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 2.17E-10 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 5.05E-78 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 4.02E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 4.32E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 NA 8.48E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 3.32E-12 8.41E-31 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013655531 4.17E-06 3.60E-11 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251