\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013651895:

Variant ID: vg1013651895 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13651895
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCTGATGAATCCGACGAGCCAAGATTGGCGGGGTGCGTCGACCTGAGGGAGCCCTAGGGCAGCACGAAGCACTGTGGCATCGACAGTGACGGTTGGGG[T/C]
GGACTAGACGTTGTGTCCGTCGAAGAAGAAGAGTTGGGTGGGGCAATGAGGGCAAGAATTGTCTCCTGGACTGCCTTGGTGGCGGAGGCGACGTCGTCCC

Reverse complement sequence

GGGACGACGTCGCCTCCGCCACCAAGGCAGTCCAGGAGACAATTCTTGCCCTCATTGCCCCACCCAACTCTTCTTCTTCGACGGACACAACGTCTAGTCC[A/G]
CCCCAACCGTCACTGTCGATGCCACAGTGCTTCGTGCTGCCCTAGGGCTCCCTCAGGTCGACGCACCCCGCCAATCTTGGCTCGTCGGATTCATCAGCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 48.20% 1.04% 2.43% NA
All Indica  2759 30.70% 67.30% 1.34% 0.58% NA
All Japonica  1512 91.40% 1.90% 0.40% 6.35% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 29.90% 66.70% 2.18% 1.18% NA
Indica II  465 12.00% 85.80% 1.94% 0.22% NA
Indica III  913 38.40% 61.00% 0.22% 0.33% NA
Indica Intermediate  786 33.50% 64.20% 1.65% 0.64% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 78.00% 2.60% 0.99% 18.45% NA
Japonica Intermediate  241 94.20% 4.60% 0.41% 0.83% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 51.10% 38.90% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013651895 T -> C LOC_Os10g26330.1 upstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:74.564; most accessible tissue: Zhenshan97 young leaf, score: 87.859 N N N N
vg1013651895 T -> C LOC_Os10g26330-LOC_Os10g26340 intergenic_region ; MODIFIER silent_mutation Average:74.564; most accessible tissue: Zhenshan97 young leaf, score: 87.859 N N N N
vg1013651895 T -> DEL N N silent_mutation Average:74.564; most accessible tissue: Zhenshan97 young leaf, score: 87.859 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013651895 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013651895 NA 1.65E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 4.70E-20 2.55E-55 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 3.76E-20 7.10E-26 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 5.31E-20 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 3.06E-20 3.65E-53 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 1.34E-20 1.24E-26 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 1.24E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 3.84E-12 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 1.59E-16 mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 8.88E-21 7.09E-59 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 6.46E-24 4.23E-34 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 3.61E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 2.92E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 2.19E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 1.05E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 2.77E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 8.03E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 NA 6.94E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 1.27E-10 8.30E-26 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651895 1.08E-10 3.45E-15 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251