\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013634162:

Variant ID: vg1013634162 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 13634162
Reference Allele: AAlternative Allele: T,G,AT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.09, A: 0.09, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAGATTCGTCTCGTGATTTTCCTCCTAACTGTACAATTAGTTTTTTTAATCTATATTTAATACTTTAAATATAACATATTATATTACTACGAATATA[A/T,G,AT]
ATATACCTCGGTTCAGATTCGTTATACTATGATTTATATTTATTATTTTTTTTACGGAGGGAGGGAGTATGTTGTTACCTGGTGCGTGCTAAAAGGGTAA

Reverse complement sequence

TTACCCTTTTAGCACGCACCAGGTAACAACATACTCCCTCCCTCCGTAAAAAAAATAATAAATATAAATCATAGTATAACGAATCTGAACCGAGGTATAT[T/A,C,AT]
TATATTCGTAGTAATATAATATGTTATATTTAAAGTATTAAATATAGATTAAAAAAACTAATTGTACAGTTAGGAGGAAAATCACGAGACGAATCTTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 21.60% 0.36% 23.91% G: 2.31%; AT: 0.57%
All Indica  2759 73.30% 1.20% 0.36% 24.79% AT: 0.25%; G: 0.07%
All Japonica  1512 2.00% 63.00% 0.26% 28.04% G: 6.75%
Aus  269 90.30% 0.00% 0.37% 1.86% AT: 7.43%
Indica I  595 69.20% 0.70% 0.50% 29.58% NA
Indica II  465 94.80% 2.40% 0.00% 2.58% G: 0.22%
Indica III  913 67.40% 0.40% 0.22% 31.76% AT: 0.22%
Indica Intermediate  786 70.50% 1.90% 0.64% 26.21% AT: 0.64%; G: 0.13%
Temperate Japonica  767 0.40% 94.50% 0.00% 4.95% G: 0.13%
Tropical Japonica  504 3.20% 21.00% 0.60% 55.56% G: 19.64%
Japonica Intermediate  241 4.60% 50.20% 0.41% 43.98% G: 0.83%
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 42.20% 31.10% 2.22% 18.89% G: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013634162 A -> AT LOC_Os10g26300-LOC_Os10g26320 intergenic_region ; MODIFIER silent_mutation Average:74.38; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg1013634162 A -> G LOC_Os10g26300-LOC_Os10g26320 intergenic_region ; MODIFIER silent_mutation Average:74.38; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg1013634162 A -> T LOC_Os10g26300-LOC_Os10g26320 intergenic_region ; MODIFIER silent_mutation Average:74.38; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg1013634162 A -> DEL N N silent_mutation Average:74.38; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013634162 A AT -0.1 -0.01 -0.01 0.11 0.1 0.08
vg1013634162 A G -0.04 -0.03 -0.03 0.0 -0.02 -0.03
vg1013634162 A T 0.03 0.02 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013634162 NA 1.76E-77 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 8.23E-58 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 2.12E-60 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 7.18E-69 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.76E-64 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.06E-54 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 2.11E-77 mr1489 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.12E-64 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 3.72E-09 2.13E-49 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 2.42E-87 mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 5.38E-07 1.46E-44 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 8.18E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 2.87E-76 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.10E-73 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.01E-84 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 2.73E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.34E-59 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 3.33E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.04E-59 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 6.89E-84 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 6.95E-62 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 5.57E-12 1.83E-58 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.96E-10 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 4.76E-85 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 NA 1.64E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013634162 1.31E-08 1.77E-27 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251