\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013626874:

Variant ID: vg1013626874 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13626874
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTAGCATTGCCTACGTTTATATAGATGTTAATGAATGTCTAGATTCATTAATATCAATATAAATATGGGAAATGCTAGAATGATTTACATTGTGAAA[T/C]
GGAGGGAGTACTAATTTTTCTTTCATCAATTTCATACATATGAATATATGTAAAAAAACAAAATACCACCGGTTTCTTAAATCCCAGGACACGTATTTCT

Reverse complement sequence

AGAAATACGTGTCCTGGGATTTAAGAAACCGGTGGTATTTTGTTTTTTTACATATATTCATATGTATGAAATTGATGAAAGAAAAATTAGTACTCCCTCC[A/G]
TTTCACAATGTAAATCATTCTAGCATTTCCCATATTTATATTGATATTAATGAATCTAGACATTCATTAACATCTATATAAACGTAGGCAATGCTAGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.20% 0.30% 0.13% NA
All Indica  2759 74.00% 25.40% 0.36% 0.22% NA
All Japonica  1512 33.20% 66.70% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 67.70% 31.60% 0.50% 0.17% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 69.40% 29.90% 0.55% 0.11% NA
Indica Intermediate  786 71.90% 27.50% 0.13% 0.51% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 67.50% 32.50% 0.00% 0.00% NA
Japonica Intermediate  241 49.00% 50.60% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 53.30% 43.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013626874 T -> C LOC_Os10g26300.1 downstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:37.631; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1013626874 T -> C LOC_Os10g26300-LOC_Os10g26320 intergenic_region ; MODIFIER silent_mutation Average:37.631; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1013626874 T -> DEL N N silent_mutation Average:37.631; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013626874 NA 2.74E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 NA 2.46E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 6.06E-35 9.04E-80 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 1.22E-19 2.48E-26 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 2.09E-11 1.38E-20 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 NA 1.56E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 NA 2.39E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 1.01E-38 2.98E-85 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 1.15E-22 1.24E-29 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 4.26E-10 1.35E-24 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 NA 4.01E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 NA 2.17E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 NA 1.27E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 2.09E-41 3.14E-98 mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 2.67E-26 9.80E-37 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 3.12E-13 2.75E-28 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 1.94E-19 1.69E-42 mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 2.34E-10 6.33E-15 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013626874 4.03E-06 1.72E-11 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251