\
| Variant ID: vg1013624010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13624010 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 218. )
TCGATTCGGATTTGGTGTGTGTGTGAGAGTTGTGGATTCGAGTTTGTGTGAGTGCTTGTTGTTGACTTCGTGAAGATTTGTGAGCACTTGCATCATCTCC[A/G]
GGAGTTCTTTGCTTCATTTGTTACTCTTGGAGGTTGAAGACTCCTAGGCGGCTAGGTGTCGCTCCCGAGCCACCGATCTACTTATGGTTGACCGGGAGAA
TTCTCCCGGTCAACCATAAGTAGATCGGTGGCTCGGGAGCGACACCTAGCCGCCTAGGAGTCTTCAACCTCCAAGAGTAACAAATGAAGCAAAGAACTCC[T/C]
GGAGATGATGCAAGTGCTCACAAATCTTCACGAAGTCAACAACAAGCACTCACACAAACTCGAATCCACAACTCTCACACACACACCAAATCCGAATCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 22.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 36.00% | 64.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 75.20% | 24.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013624010 | A -> G | LOC_Os10g26300.1 | upstream_gene_variant ; 584.0bp to feature; MODIFIER | silent_mutation | Average:22.828; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg1013624010 | A -> G | LOC_Os10g26290-LOC_Os10g26300 | intergenic_region ; MODIFIER | silent_mutation | Average:22.828; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013624010 | NA | 1.24E-10 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 3.84E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 2.68E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 9.88E-08 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | 1.68E-06 | 1.68E-06 | mr1424 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 8.22E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | 2.01E-07 | 7.61E-37 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | 2.67E-07 | 1.17E-14 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 1.24E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 7.33E-32 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 4.00E-14 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | 3.04E-06 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | 4.45E-06 | 1.26E-15 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013624010 | NA | 8.56E-07 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |